Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0211205571:

Variant ID: vg0211205571 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 11205571
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 336. )

Flanking Sequence (100 bp) in Reference Genome:

GATGGATGACTGGCATTTGTAAATCCCCTTTTCCTTCCCTTTCCTTTAGTTTCCTATCCATCAGGGAGGACGCCATAGTAAAACAAAGCTCTGCAGCACA[T/A]
AGTGTGGGGAAACCTGCTGGGTTTCATGCACGATCTCTCATGTATTCCATCTTACTGTTTGTCACATTTATTTCTTAATTCATGCTGAAAAGATATTTCG

Reverse complement sequence

CGAAATATCTTTTCAGCATGAATTAAGAAATAAATGTGACAAACAGTAAGATGGAATACATGAGAGATCGTGCATGAAACCCAGCAGGTTTCCCCACACT[A/T]
TGTGCTGCAGAGCTTTGTTTTACTATGGCGTCCTCCCTGATGGATAGGAAACTAAAGGAAAGGGAAGGAAAAGGGGATTTACAAATGCCAGTCATCCATC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.70%	25.50%	0.76%	0.00%	NA
All Indica	2759	99.10%	0.90%	0.00%	0.00%	NA
All Japonica	1512	27.10%	70.60%	2.25%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.80%	2.20%	0.00%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	98.70%	1.30%	0.00%	0.00%	NA
Temperate Japonica	767	13.70%	82.50%	3.78%	0.00%	NA
Tropical Japonica	504	47.60%	52.20%	0.20%	0.00%	NA
Japonica Intermediate	241	27.00%	71.40%	1.66%	0.00%	NA
VI/Aromatic	96	10.40%	88.50%	1.04%	0.00%	NA
Intermediate	90	66.70%	32.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0211205571	T -> A	LOC_Os02g19210.1	3_prime_UTR_variant ; 121.0bp to feature; MODIFIER	silent_mutation	Average:80.274; most accessible tissue: Callus, score: 93.592	N	N	N	N
vg0211205571	T -> A	LOC_Os02g19210.2	3_prime_UTR_variant ; 1172.0bp to feature; MODIFIER	silent_mutation	Average:80.274; most accessible tissue: Callus, score: 93.592	N	N	N	N
vg0211205571	T -> A	LOC_Os02g19220.1	downstream_gene_variant ; 3465.0bp to feature; MODIFIER	silent_mutation	Average:80.274; most accessible tissue: Callus, score: 93.592	N	N	N	N
vg0211205571	T -> A	LOC_Os02g19220.2	downstream_gene_variant ; 3466.0bp to feature; MODIFIER	silent_mutation	Average:80.274; most accessible tissue: Callus, score: 93.592	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0211205571	NA	3.11E-12	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	NA	9.66E-13	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	5.35E-07	NA	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	NA	2.71E-07	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	NA	6.22E-06	mr1043_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	NA	5.26E-06	mr1177_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	NA	6.43E-06	mr1222_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	NA	4.96E-09	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	NA	3.47E-14	mr1537_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	NA	1.56E-11	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	NA	1.05E-10	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	NA	5.13E-09	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	NA	1.46E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	NA	1.21E-12	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	NA	1.32E-08	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	NA	3.02E-10	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	NA	8.59E-06	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	NA	5.06E-09	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	NA	5.87E-08	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	NA	7.07E-09	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	NA	1.05E-07	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	NA	9.42E-16	mr1842_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	NA	6.58E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	4.12E-07	NA	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	NA	1.81E-14	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211205571	NA	1.58E-06	mr1929_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251