\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0211188163:

Variant ID: vg0211188163 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 11188163
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, C: 0.05, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


ATCAAACATGAAAAGTTGGTATATCTAAGCAATGTTCAGAATAATAAGAACTACTCCAGTAGTAAAAAATTTCTAGTTAACCTAGATATCTCACTTGAAC[T/C]
TATCACTAAGTTTACTACCTTAATTAAATTGGTCACAATGGTCAGATTTAAATTAAATTAAATTAAACAGCAGCTGCACATAATTTTCAGTGTTAAACCT

Reverse complement sequence

AGGTTTAACACTGAAAATTATGTGCAGCTGCTGTTTAATTTAATTTAATTTAAATCTGACCATTGTGACCAATTTAATTAAGGTAGTAAACTTAGTGATA[A/G]
GTTCAAGTGAGATATCTAGGTTAACTAGAAATTTTTTACTACTGGAGTAGTTCTTATTATTCTGAACATTGCTTAGATATACCAACTTTTCATGTTTGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.00% 39.90% 0.06% 0.02% NA
All Indica  2759 94.50% 5.50% 0.04% 0.00% NA
All Japonica  1512 1.60% 98.30% 0.00% 0.07% NA
Aus  269 57.20% 42.80% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 88.90% 11.10% 0.00% 0.00% NA
Indica Intermediate  786 95.50% 4.30% 0.13% 0.00% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 2.80% 97.00% 0.00% 0.20% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 47.80% 50.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0211188163 T -> DEL N N silent_mutation Average:68.981; most accessible tissue: Zhenshan97 panicle, score: 84.824 N N N N
vg0211188163 T -> C LOC_Os02g19180.1 upstream_gene_variant ; 3774.0bp to feature; MODIFIER silent_mutation Average:68.981; most accessible tissue: Zhenshan97 panicle, score: 84.824 N N N N
vg0211188163 T -> C LOC_Os02g19200.1 downstream_gene_variant ; 267.0bp to feature; MODIFIER silent_mutation Average:68.981; most accessible tissue: Zhenshan97 panicle, score: 84.824 N N N N
vg0211188163 T -> C LOC_Os02g19180-LOC_Os02g19200 intergenic_region ; MODIFIER silent_mutation Average:68.981; most accessible tissue: Zhenshan97 panicle, score: 84.824 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0211188163 NA 2.23E-37 mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 1.51E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 3.13E-40 mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 2.96E-08 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 2.39E-78 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 1.25E-34 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 3.57E-51 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 2.25E-59 mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 1.56E-45 mr1070_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 6.69E-77 mr1088_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 3.14E-18 mr1131_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 1.56E-43 mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 1.54E-36 mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 5.01E-19 mr1199_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 1.04E-36 mr1224_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 2.34E-38 mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 3.17E-40 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 7.44E-78 mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 1.53E-36 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 3.86E-42 mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 4.21E-24 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 5.93E-12 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 3.55E-51 mr1404_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 9.52E-37 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 1.04E-44 mr1437_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 5.32E-23 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 4.43E-47 mr1620_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 7.15E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 6.01E-16 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 1.33E-49 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 5.68E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 4.21E-06 NA mr1731_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 7.06E-67 mr1733_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 1.60E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 1.89E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 2.37E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 1.99E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 7.29E-35 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 1.42E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 2.56E-25 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 9.72E-15 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211188163 NA 9.50E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251