\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0211187902:

Variant ID: vg0211187902 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 11187902
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


AGGAACTATAGCTAGCCTAGAGTAGACTGATTTTAAGGTTCCTTAGAAGATGGGTACTCCCTCCGTTTCACATCTATTCATTAACATCAATACGAAAGTG[G/A]
GAAATGTTAAAATAACTTACATTGTGAAACGGAGTAAGTAGTATTTATCCCCACAATTTTGTGAAGATGTGAGCAGTGGCAAGTTTGTTTTTTTTCTTTG

Reverse complement sequence

CAAAGAAAAAAAACAAACTTGCCACTGCTCACATCTTCACAAAATTGTGGGGATAAATACTACTTACTCCGTTTCACAATGTAAGTTATTTTAACATTTC[C/T]
CACTTTCGTATTGATGTTAATGAATAGATGTGAAACGGAGGGAGTACCCATCTTCTAAGGAACCTTAAAATCAGTCTACTCTAGGCTAGCTATAGTTCCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.60% 42.60% 1.50% 2.33% NA
All Indica  2759 73.40% 25.80% 0.76% 0.00% NA
All Japonica  1512 20.20% 69.70% 2.91% 7.21% NA
Aus  269 57.20% 42.80% 0.00% 0.00% NA
Indica I  595 70.40% 28.70% 0.84% 0.00% NA
Indica II  465 64.90% 33.50% 1.51% 0.00% NA
Indica III  913 82.70% 16.90% 0.44% 0.00% NA
Indica Intermediate  786 70.00% 29.40% 0.64% 0.00% NA
Temperate Japonica  767 1.00% 82.10% 4.17% 12.65% NA
Tropical Japonica  504 45.80% 52.20% 1.19% 0.79% NA
Japonica Intermediate  241 27.40% 66.80% 2.49% 3.32% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 42.20% 50.00% 6.67% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0211187902 G -> A LOC_Os02g19180.1 upstream_gene_variant ; 3513.0bp to feature; MODIFIER silent_mutation Average:88.573; most accessible tissue: Minghui63 panicle, score: 93.521 N N N N
vg0211187902 G -> A LOC_Os02g19200.1 downstream_gene_variant ; 528.0bp to feature; MODIFIER silent_mutation Average:88.573; most accessible tissue: Minghui63 panicle, score: 93.521 N N N N
vg0211187902 G -> A LOC_Os02g19170.3 downstream_gene_variant ; 4744.0bp to feature; MODIFIER silent_mutation Average:88.573; most accessible tissue: Minghui63 panicle, score: 93.521 N N N N
vg0211187902 G -> A LOC_Os02g19180-LOC_Os02g19200 intergenic_region ; MODIFIER silent_mutation Average:88.573; most accessible tissue: Minghui63 panicle, score: 93.521 N N N N
vg0211187902 G -> DEL N N silent_mutation Average:88.573; most accessible tissue: Minghui63 panicle, score: 93.521 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0211187902 G A -0.01 -0.02 -0.02 0.0 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0211187902 3.90E-06 2.25E-10 mr1042_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211187902 NA 2.62E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211187902 NA 1.67E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211187902 5.34E-06 5.34E-06 mr1146_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211187902 NA 2.23E-06 mr1222_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211187902 NA 7.71E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211187902 NA 7.17E-06 mr1479_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211187902 NA 6.65E-09 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211187902 NA 4.76E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211187902 NA 1.76E-07 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211187902 NA 1.47E-08 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211187902 NA 1.87E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211187902 NA 4.00E-06 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211187902 NA 1.64E-10 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211187902 NA 5.79E-06 mr1751_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211187902 NA 7.60E-06 mr1759_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211187902 NA 9.59E-06 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211187902 NA 1.82E-08 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211187902 NA 2.53E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211187902 NA 2.60E-09 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211187902 NA 3.29E-08 mr1929_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211187902 NA 6.96E-06 mr1976_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251