\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0211098718:

Variant ID: vg0211098718 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 11098718
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.22, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


AAATATATTTAATTATTGATTTGATGAAACTAATTTAGTATTATAATTATGAGAGGGGAGGGGAAGTAGAGGCTGACATCTAGGATCCACCCTTAGTCAG[C/T]
TGTCACGTCAGACAAAACTGGAGTGAAAACCACTTAGGAACCTAGTTTGCACTGGTTTTGTAAGTTGGGGGATGTGTTGTATCCGGTTTTGCAGTTTAAG

Reverse complement sequence

CTTAAACTGCAAAACCGGATACAACACATCCCCCAACTTACAAAACCAGTGCAAACTAGGTTCCTAAGTGGTTTTCACTCCAGTTTTGTCTGACGTGACA[G/A]
CTGACTAAGGGTGGATCCTAGATGTCAGCCTCTACTTCCCCTCCCCTCTCATAATTATAATACTAAATTAGTTTCATCAAATCAATAATTAAATATATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.10% 34.50% 0.44% 25.90% NA
All Indica  2759 2.60% 57.70% 0.72% 38.93% NA
All Japonica  1512 98.10% 0.70% 0.07% 1.19% NA
Aus  269 54.30% 2.60% 0.00% 43.12% NA
Indica I  595 1.50% 69.10% 0.50% 28.91% NA
Indica II  465 3.20% 40.40% 1.08% 55.27% NA
Indica III  913 1.00% 57.60% 0.55% 40.85% NA
Indica Intermediate  786 5.00% 59.50% 0.89% 34.61% NA
Temperate Japonica  767 98.80% 0.30% 0.00% 0.91% NA
Tropical Japonica  504 96.60% 1.40% 0.20% 1.79% NA
Japonica Intermediate  241 98.80% 0.40% 0.00% 0.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 58.90% 23.30% 0.00% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0211098718 C -> T LOC_Os02g19000.1 upstream_gene_variant ; 2492.0bp to feature; MODIFIER silent_mutation Average:82.687; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg0211098718 C -> T LOC_Os02g18990.1 downstream_gene_variant ; 925.0bp to feature; MODIFIER silent_mutation Average:82.687; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg0211098718 C -> T LOC_Os02g18990-LOC_Os02g19000 intergenic_region ; MODIFIER silent_mutation Average:82.687; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg0211098718 C -> DEL N N silent_mutation Average:82.687; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0211098718 C T -0.02 -0.02 -0.01 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0211098718 NA 2.12E-25 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211098718 NA 4.05E-58 mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211098718 NA 2.47E-09 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211098718 NA 1.15E-25 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211098718 NA 2.36E-62 mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211098718 NA 6.76E-11 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211098718 NA 4.05E-44 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211098718 NA 3.23E-67 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211098718 NA 9.82E-54 mr1558 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211098718 NA 1.31E-08 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211098718 NA 5.07E-20 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211098718 NA 3.94E-42 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211098718 NA 1.81E-56 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211098718 NA 1.32E-29 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211098718 NA 1.34E-73 mr1088_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211098718 NA 5.42E-37 mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211098718 NA 7.32E-77 mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211098718 NA 1.38E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211098718 NA 1.77E-45 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211098718 NA 5.84E-65 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211098718 NA 7.41E-07 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211098718 NA 1.21E-18 mr1581_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211098718 NA 1.05E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251