Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0210856039:

Variant ID: vg0210856039 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 10856039
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

CCACTACTCCTACATAATTGAGAAAAATTACCCACCTATGCCATCAACCGAACAGATAGCTGAGGGCATTATAGACTTTAGCTTTTCAAACCCAATAATC[C/T]
ATACCTCCAATAATCCAAACAAATAAACAACTCACAGCTTATTCTATGTCAGCTTATTATAATCCAGTTTATAGTAATCTGGCTTAATAATCTAGATTAT

Reverse complement sequence

ATAATCTAGATTATTAAGCCAGATTACTATAAACTGGATTATAATAAGCTGACATAGAATAAGCTGTGAGTTGTTTATTTGTTTGGATTATTGGAGGTAT[G/A]
GATTATTGGGTTTGAAAAGCTAAAGTCTATAATGCCCTCAGCTATCTGTTCGGTTGATGGCATAGGTGGGTAATTTTTCTCAATTATGTAGGAGTAGTGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.80%	28.10%	0.36%	7.70%	NA
All Indica	2759	44.30%	42.40%	0.51%	12.87%	NA
All Japonica	1512	98.70%	0.90%	0.00%	0.33%	NA
Aus	269	51.30%	48.00%	0.74%	0.00%	NA
Indica I	595	44.70%	52.80%	0.17%	2.35%	NA
Indica II	465	41.30%	37.00%	1.08%	20.65%	NA
Indica III	913	49.20%	30.90%	0.33%	19.61%	NA
Indica Intermediate	786	39.90%	51.00%	0.64%	8.40%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	98.00%	1.20%	0.00%	0.79%	NA
Japonica Intermediate	241	99.20%	0.40%	0.00%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	75.60%	18.90%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0210856039	C -> T	LOC_Os02g18612.1	upstream_gene_variant ; 2119.0bp to feature; MODIFIER	silent_mutation	Average:59.876; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0210856039	C -> T	LOC_Os02g18614.1	downstream_gene_variant ; 1359.0bp to feature; MODIFIER	silent_mutation	Average:59.876; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0210856039	C -> T	LOC_Os02g18620.1	downstream_gene_variant ; 451.0bp to feature; MODIFIER	silent_mutation	Average:59.876; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0210856039	C -> T	LOC_Os02g18630.1	downstream_gene_variant ; 1513.0bp to feature; MODIFIER	silent_mutation	Average:59.876; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0210856039	C -> T	LOC_Os02g18620-LOC_Os02g18630	intergenic_region ; MODIFIER	silent_mutation	Average:59.876; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0210856039	C -> DEL	N	N	silent_mutation	Average:59.876; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0210856039	NA	2.43E-06	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	9.28E-07	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	2.41E-06	mr1060_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	5.51E-06	mr1064_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	2.16E-06	mr1296_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	2.32E-07	mr1296_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	2.62E-10	mr1349_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	4.45E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	5.11E-08	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	1.28E-06	mr1358_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	3.82E-07	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	1.98E-06	mr1446_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	1.76E-08	mr1452_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	3.73E-07	mr1452_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	2.46E-08	mr1454_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	2.25E-06	mr1470_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	8.11E-08	mr1474_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	2.47E-07	mr1474_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	7.17E-09	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	3.03E-06	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	6.30E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	3.98E-06	mr1743_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	1.06E-06	mr1836_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	2.64E-06	mr1899_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	1.80E-06	mr1899_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039	NA	1.31E-06	mr1971_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251