\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0210856039:

Variant ID: vg0210856039 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 10856039
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


CCACTACTCCTACATAATTGAGAAAAATTACCCACCTATGCCATCAACCGAACAGATAGCTGAGGGCATTATAGACTTTAGCTTTTCAAACCCAATAATC[C/T]
ATACCTCCAATAATCCAAACAAATAAACAACTCACAGCTTATTCTATGTCAGCTTATTATAATCCAGTTTATAGTAATCTGGCTTAATAATCTAGATTAT

Reverse complement sequence

ATAATCTAGATTATTAAGCCAGATTACTATAAACTGGATTATAATAAGCTGACATAGAATAAGCTGTGAGTTGTTTATTTGTTTGGATTATTGGAGGTAT[G/A]
GATTATTGGGTTTGAAAAGCTAAAGTCTATAATGCCCTCAGCTATCTGTTCGGTTGATGGCATAGGTGGGTAATTTTTCTCAATTATGTAGGAGTAGTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.80% 28.10% 0.36% 7.70% NA
All Indica  2759 44.30% 42.40% 0.51% 12.87% NA
All Japonica  1512 98.70% 0.90% 0.00% 0.33% NA
Aus  269 51.30% 48.00% 0.74% 0.00% NA
Indica I  595 44.70% 52.80% 0.17% 2.35% NA
Indica II  465 41.30% 37.00% 1.08% 20.65% NA
Indica III  913 49.20% 30.90% 0.33% 19.61% NA
Indica Intermediate  786 39.90% 51.00% 0.64% 8.40% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 1.20% 0.00% 0.79% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 75.60% 18.90% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0210856039 C -> T LOC_Os02g18612.1 upstream_gene_variant ; 2119.0bp to feature; MODIFIER silent_mutation Average:59.876; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0210856039 C -> T LOC_Os02g18614.1 downstream_gene_variant ; 1359.0bp to feature; MODIFIER silent_mutation Average:59.876; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0210856039 C -> T LOC_Os02g18620.1 downstream_gene_variant ; 451.0bp to feature; MODIFIER silent_mutation Average:59.876; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0210856039 C -> T LOC_Os02g18630.1 downstream_gene_variant ; 1513.0bp to feature; MODIFIER silent_mutation Average:59.876; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0210856039 C -> T LOC_Os02g18620-LOC_Os02g18630 intergenic_region ; MODIFIER silent_mutation Average:59.876; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0210856039 C -> DEL N N silent_mutation Average:59.876; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0210856039 NA 2.43E-06 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 9.28E-07 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 2.41E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 5.51E-06 mr1064_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 2.16E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 2.32E-07 mr1296_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 2.62E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 4.45E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 5.11E-08 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 1.28E-06 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 3.82E-07 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 1.98E-06 mr1446_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 1.76E-08 mr1452_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 3.73E-07 mr1452_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 2.46E-08 mr1454_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 2.25E-06 mr1470_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 8.11E-08 mr1474_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 2.47E-07 mr1474_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 7.17E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 3.03E-06 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 6.30E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 3.98E-06 mr1743_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 1.06E-06 mr1836_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 2.64E-06 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 1.80E-06 mr1899_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210856039 NA 1.31E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251