\
| Variant ID: vg0210828426 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 10828426 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 281. )
GAAGCTCCCTATGACCCCGTACTTAACGATGATCTCCCATGATGGACAGAACGACTACGGGAATCAGTAGCCAATCTCAGTAACGCGTTCGAGGAGGTCG[C/T]
TACCAGAGCACAACCAGAACATCTGACGGTTGGCGGTGCCGACGGCGAACCACCGGAGCAACGGACGTCGCCTAGACGAGCTACCCCTCCACCTCGCGGC
GCCGCGAGGTGGAGGGGTAGCTCGTCTAGGCGACGTCCGTTGCTCCGGTGGTTCGCCGTCGGCACCGCCAACCGTCAGATGTTCTGGTTGTGCTCTGGTA[G/A]
CGACCTCCTCGAACGCGTTACTGAGATTGGCTACTGATTCCCGTAGTCGTTCTGTCCATCATGGGAGATCATCGTTAAGTACGGGGTCATAGGGAGCTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.20% | 1.90% | 0.89% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 91.60% | 6.00% | 2.38% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 86.80% | 8.70% | 4.43% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.60% | 10.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0210828426 | C -> T | LOC_Os02g18550.1 | upstream_gene_variant ; 2699.0bp to feature; MODIFIER | silent_mutation | Average:70.079; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 | N | N | N | N |
| vg0210828426 | C -> T | LOC_Os02g18570.1 | downstream_gene_variant ; 3454.0bp to feature; MODIFIER | silent_mutation | Average:70.079; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 | N | N | N | N |
| vg0210828426 | C -> T | LOC_Os02g18560.1 | intron_variant ; MODIFIER | silent_mutation | Average:70.079; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0210828426 | NA | 7.43E-06 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210828426 | 6.16E-08 | 6.16E-08 | mr1317_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210828426 | 2.52E-08 | 2.52E-08 | mr1897_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210828426 | 1.37E-07 | 1.37E-07 | mr1914_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |