\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0210775892:

Variant ID: vg0210775892 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 10775892
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, A: 0.07, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


TCCCCACACAAAATTAGCCCCATTAGCACCCCTTGGAGGGGCTAATGTTTTGAGGGGGGCTAATTCACATTAGCTCAAAATTAGCCCACCTGTTTGGATC[C/A,T]
TTGAGGGCTAAACATTAGCCCATGGAACCAAACAGGGCTTAACACGTCAACTATTATCTTTTGTTGTATAATGAATCATATATGACACAGATTATTAATT

Reverse complement sequence

AATTAATAATCTGTGTCATATATGATTCATTATACAACAAAAGATAATAGTTGACGTGTTAAGCCCTGTTTGGTTCCATGGGCTAATGTTTAGCCCTCAA[G/T,A]
GATCCAAACAGGTGGGCTAATTTTGAGCTAATGTGAATTAGCCCCCCTCAAAACATTAGCCCCTCCAAGGGGTGCTAATGGGGCTAATTTTGTGTGGGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.00% 24.80% 0.19% 0.06% T: 0.02%
All Indica  2759 58.50% 41.10% 0.25% 0.11% T: 0.04%
All Japonica  1512 99.40% 0.60% 0.00% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 46.40% 52.90% 0.34% 0.17% T: 0.17%
Indica II  465 62.60% 36.80% 0.22% 0.43% NA
Indica III  913 70.30% 29.70% 0.00% 0.00% NA
Indica Intermediate  786 51.70% 47.80% 0.51% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 78.90% 18.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0210775892 C -> A LOC_Os02g18500.1 upstream_gene_variant ; 2003.0bp to feature; MODIFIER silent_mutation Average:74.452; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0210775892 C -> A LOC_Os02g18510.1 downstream_gene_variant ; 392.0bp to feature; MODIFIER silent_mutation Average:74.452; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0210775892 C -> A LOC_Os02g18500-LOC_Os02g18510 intergenic_region ; MODIFIER silent_mutation Average:74.452; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0210775892 C -> T LOC_Os02g18500.1 upstream_gene_variant ; 2003.0bp to feature; MODIFIER silent_mutation Average:74.452; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0210775892 C -> T LOC_Os02g18510.1 downstream_gene_variant ; 392.0bp to feature; MODIFIER silent_mutation Average:74.452; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0210775892 C -> T LOC_Os02g18500-LOC_Os02g18510 intergenic_region ; MODIFIER silent_mutation Average:74.452; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0210775892 C -> DEL N N silent_mutation Average:74.452; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0210775892 C A 0.03 0.0 0.0 0.0 0.03 0.04
vg0210775892 C T 0.0 -0.01 -0.01 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0210775892 NA 5.33E-10 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 2.42E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 8.11E-07 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 7.54E-06 mr1064_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 4.91E-06 mr1186_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 2.12E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 3.07E-07 mr1296_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 1.26E-11 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 8.95E-06 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 6.15E-08 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 2.92E-06 mr1355_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 8.38E-08 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 9.46E-06 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 2.38E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 1.27E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 4.86E-08 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 2.24E-07 mr1452_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 1.79E-06 NA mr1454_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 5.31E-07 4.46E-09 mr1454_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 6.84E-06 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 2.19E-06 mr1470_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 6.38E-08 mr1474_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 7.59E-07 mr1474_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 8.97E-11 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 3.80E-07 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 6.81E-06 mr1743_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 3.34E-08 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 6.10E-07 mr1899_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210775892 NA 4.27E-07 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251