\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0210675135:

Variant ID: vg0210675135 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 10675135
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGGATTTGCCCCTCCTATAGAGAGATATCTATGGGCTCCTCAATGTTGTAGATTATGGAAGTGCATGGCCATGCCAAAGGTGGTTGAGGAGTCAATCA[C/T]
AAGTTATATAATCTATCACAGGTTCGATTGAATGATTGAGCTATTAGAGGATGGCACATATCTAACCTTGAGCTTAATCGATATCATGAGGCAAAGGGGT

Reverse complement sequence

ACCCCTTTGCCTCATGATATCGATTAAGCTCAAGGTTAGATATGTGCCATCCTCTAATAGCTCAATCATTCAATCGAACCTGTGATAGATTATATAACTT[G/A]
TGATTGACTCCTCAACCACCTTTGGCATGGCCATGCACTTCCATAATCTACAACATTGAGGAGCCCATAGATATCTCTCTATAGGAGGGGCAAATCCCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.70% 13.30% 0.00% 0.00% NA
All Indica  2759 77.50% 22.50% 0.00% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 84.40% 15.60% 0.00% 0.00% NA
Indica II  465 69.70% 30.30% 0.00% 0.00% NA
Indica III  913 75.10% 24.90% 0.00% 0.00% NA
Indica Intermediate  786 79.80% 20.20% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0210675135 C -> T LOC_Os02g18350.1 downstream_gene_variant ; 1947.0bp to feature; MODIFIER silent_mutation Average:56.838; most accessible tissue: Minghui63 flag leaf, score: 72.907 N N N N
vg0210675135 C -> T LOC_Os02g18340-LOC_Os02g18350 intergenic_region ; MODIFIER silent_mutation Average:56.838; most accessible tissue: Minghui63 flag leaf, score: 72.907 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0210675135 NA 1.47E-06 mr1186 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210675135 NA 4.83E-07 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210675135 NA 3.19E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210675135 NA 2.39E-06 mr1439_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210675135 NA 9.27E-06 mr1449_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210675135 NA 2.22E-06 mr1836_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210675135 NA 6.10E-06 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251