\
| Variant ID: vg0210675135 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 10675135 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )
ATGGGATTTGCCCCTCCTATAGAGAGATATCTATGGGCTCCTCAATGTTGTAGATTATGGAAGTGCATGGCCATGCCAAAGGTGGTTGAGGAGTCAATCA[C/T]
AAGTTATATAATCTATCACAGGTTCGATTGAATGATTGAGCTATTAGAGGATGGCACATATCTAACCTTGAGCTTAATCGATATCATGAGGCAAAGGGGT
ACCCCTTTGCCTCATGATATCGATTAAGCTCAAGGTTAGATATGTGCCATCCTCTAATAGCTCAATCATTCAATCGAACCTGTGATAGATTATATAACTT[G/A]
TGATTGACTCCTCAACCACCTTTGGCATGGCCATGCACTTCCATAATCTACAACATTGAGGAGCCCATAGATATCTCTCTATAGGAGGGGCAAATCCCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 77.50% | 22.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 69.70% | 30.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 75.10% | 24.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 79.80% | 20.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0210675135 | C -> T | LOC_Os02g18350.1 | downstream_gene_variant ; 1947.0bp to feature; MODIFIER | silent_mutation | Average:56.838; most accessible tissue: Minghui63 flag leaf, score: 72.907 | N | N | N | N |
| vg0210675135 | C -> T | LOC_Os02g18340-LOC_Os02g18350 | intergenic_region ; MODIFIER | silent_mutation | Average:56.838; most accessible tissue: Minghui63 flag leaf, score: 72.907 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0210675135 | NA | 1.47E-06 | mr1186 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210675135 | NA | 4.83E-07 | mr1360_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210675135 | NA | 3.19E-06 | mr1360_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210675135 | NA | 2.39E-06 | mr1439_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210675135 | NA | 9.27E-06 | mr1449_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210675135 | NA | 2.22E-06 | mr1836_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210675135 | NA | 6.10E-06 | mr1882_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |