\
| Variant ID: vg0210662977 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 10662977 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GATCATGTGTACCTTCGTGTCACGCCTCTCCGAGGGGTTCATCGTTTCCACACCAAAGGAAAATTGGCACCACGTTTCGTGGGACCTTATAAGATTGTCA[G/A]
TCAAAGAGGTGAGGTTGCTTATCAGTTGGAGTTACCTCAATCCTTGGCAGGTGTTCATAATGTGATCCATGTGTCAAAGTTGAAAAAGTGTTAAAGGGTA
TACCCTTTAACACTTTTTCAACTTTGACACATGGATCACATTATGAACACCTGCCAAGGATTGAGGTAACTCCAACTGATAAGCAACCTCACCTCTTTGA[C/T]
TGACAATCTTATAAGGTCCCACGAAACGTGGTGCCAATTTTCCTTTGGTGTGGAAACGATGAACCCCTCGGAGAGGCGTGACACGAAGGTACACATGATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.50% | 8.20% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 85.60% | 14.00% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 72.80% | 26.10% | 1.18% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.50% | 6.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 80.00% | 19.60% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0210662977 | G -> A | LOC_Os02g18340.1 | missense_variant ; p.Ser1474Asn; MODERATE | nonsynonymous_codon ; S1474N | Average:39.672; most accessible tissue: Minghui63 flag leaf, score: 51.386 | benign |
0.531 |
DELETERIOUS | 0.03 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0210662977 | NA | 3.63E-06 | mr1115_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210662977 | NA | 1.71E-06 | mr1173_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210662977 | 3.37E-06 | 3.37E-06 | mr1173_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210662977 | NA | 1.31E-06 | mr1296_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210662977 | NA | 4.42E-06 | mr1296_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210662977 | NA | 6.19E-07 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210662977 | NA | 2.29E-06 | mr1580_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210662977 | NA | 1.82E-06 | mr1756_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210662977 | NA | 5.64E-06 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210662977 | NA | 7.45E-06 | mr1899_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210662977 | NA | 2.97E-07 | mr1971_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |