\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0210647689:

Variant ID: vg0210647689 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 10647689
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGTTCCTAATCTAACCGGTAGAGAAGAGGAGATCGCTCCTCTCTCTCCCTTTGGCGTCCCTCTCGACAACCGACGCGATGTTCCCAAACATCGCGTCCC[C/T]
TGCGGTTGACACCGCTTCACATTGTATAAATGTACTGTTGCCGCCCCCTCCTACCTTTTGCTGCCGGGCCGGATGGGCCGGCCCAGCACCCCTCGCTTCC

Reverse complement sequence

GGAAGCGAGGGGTGCTGGGCCGGCCCATCCGGCCCGGCAGCAAAAGGTAGGAGGGGGCGGCAACAGTACATTTATACAATGTGAAGCGGTGTCAACCGCA[G/A]
GGGACGCGATGTTTGGGAACATCGCGTCGGTTGTCGAGAGGGACGCCAAAGGGAGAGAGAGGAGCGATCTCCTCTTCTCTACCGGTTAGATTAGGAACCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 8.40% 0.11% 0.00% NA
All Indica  2759 85.60% 14.20% 0.18% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 71.80% 27.60% 0.67% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 93.40% 6.60% 0.00% 0.00% NA
Indica Intermediate  786 80.70% 19.20% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0210647689 C -> T LOC_Os02g18330.1 upstream_gene_variant ; 73.0bp to feature; MODIFIER silent_mutation Average:68.699; most accessible tissue: Minghui63 root, score: 77.009 N N N N
vg0210647689 C -> T LOC_Os02g18320-LOC_Os02g18330 intergenic_region ; MODIFIER silent_mutation Average:68.699; most accessible tissue: Minghui63 root, score: 77.009 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0210647689 NA 1.44E-06 mr1115 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210647689 NA 5.80E-07 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210647689 NA 6.18E-06 mr1165_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210647689 NA 7.93E-06 mr1345_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210647689 NA 4.33E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210647689 NA 4.84E-06 mr1820_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210647689 NA 2.26E-06 mr1876_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251