\
| Variant ID: vg0210647689 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 10647689 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGGTTCCTAATCTAACCGGTAGAGAAGAGGAGATCGCTCCTCTCTCTCCCTTTGGCGTCCCTCTCGACAACCGACGCGATGTTCCCAAACATCGCGTCCC[C/T]
TGCGGTTGACACCGCTTCACATTGTATAAATGTACTGTTGCCGCCCCCTCCTACCTTTTGCTGCCGGGCCGGATGGGCCGGCCCAGCACCCCTCGCTTCC
GGAAGCGAGGGGTGCTGGGCCGGCCCATCCGGCCCGGCAGCAAAAGGTAGGAGGGGGCGGCAACAGTACATTTATACAATGTGAAGCGGTGTCAACCGCA[G/A]
GGGACGCGATGTTTGGGAACATCGCGTCGGTTGTCGAGAGGGACGCCAAAGGGAGAGAGAGGAGCGATCTCCTCTTCTCTACCGGTTAGATTAGGAACCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.50% | 8.40% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 85.60% | 14.20% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 71.80% | 27.60% | 0.67% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 80.70% | 19.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0210647689 | C -> T | LOC_Os02g18330.1 | upstream_gene_variant ; 73.0bp to feature; MODIFIER | silent_mutation | Average:68.699; most accessible tissue: Minghui63 root, score: 77.009 | N | N | N | N |
| vg0210647689 | C -> T | LOC_Os02g18320-LOC_Os02g18330 | intergenic_region ; MODIFIER | silent_mutation | Average:68.699; most accessible tissue: Minghui63 root, score: 77.009 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0210647689 | NA | 1.44E-06 | mr1115 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210647689 | NA | 5.80E-07 | mr1115_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210647689 | NA | 6.18E-06 | mr1165_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210647689 | NA | 7.93E-06 | mr1345_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210647689 | NA | 4.33E-06 | mr1611_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210647689 | NA | 4.84E-06 | mr1820_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210647689 | NA | 2.26E-06 | mr1876_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |