\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0210593337:

Variant ID: vg0210593337 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 10593337
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.14, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


CGTTGTGACCTCTGCTCCTGCGATTGGATCCTGCGCCGGCGATGCTGAGGCTTGGCTGGTGATAATCTTGAGATCGAAGATGGGGAACTCGGCTGCCAGT[T/C]
GGCGTGCGGACGCTTGCGGAGTTAACCGGGACCGAGGCAGTAATCATGGTCTTGGTCTGGTTCAAGATGTTGACGACGTGATCAGCTTGGTTGAGCGCAT

Reverse complement sequence

ATGCGCTCAACCAAGCTGATCACGTCGTCAACATCTTGAACCAGACCAAGACCATGATTACTGCCTCGGTCCCGGTTAACTCCGCAAGCGTCCGCACGCC[A/G]
ACTGGCAGCCGAGTTCCCCATCTTCGATCTCAAGATTATCACCAGCCAAGCCTCAGCATCGCCGGCGCAGGATCCAATCGCAGGAGCAGAGGTCACAACG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.60% 20.80% 1.35% 24.16% NA
All Indica  2759 27.10% 29.90% 2.32% 40.63% NA
All Japonica  1512 98.90% 0.70% 0.00% 0.46% NA
Aus  269 50.20% 49.80% 0.00% 0.00% NA
Indica I  595 34.10% 33.60% 1.68% 30.59% NA
Indica II  465 14.40% 38.90% 2.15% 44.52% NA
Indica III  913 33.70% 18.60% 2.52% 45.13% NA
Indica Intermediate  786 21.80% 34.90% 2.67% 40.71% NA
Temperate Japonica  767 99.00% 0.90% 0.00% 0.13% NA
Tropical Japonica  504 98.80% 0.20% 0.00% 0.99% NA
Japonica Intermediate  241 98.80% 0.80% 0.00% 0.41% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 67.80% 16.70% 0.00% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0210593337 T -> DEL N N silent_mutation Average:31.884; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg0210593337 T -> C LOC_Os02g18240.1 upstream_gene_variant ; 3384.0bp to feature; MODIFIER silent_mutation Average:31.884; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg0210593337 T -> C LOC_Os02g18250.1 downstream_gene_variant ; 1486.0bp to feature; MODIFIER silent_mutation Average:31.884; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg0210593337 T -> C LOC_Os02g18260.1 downstream_gene_variant ; 231.0bp to feature; MODIFIER silent_mutation Average:31.884; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg0210593337 T -> C LOC_Os02g18270.1 downstream_gene_variant ; 2065.0bp to feature; MODIFIER silent_mutation Average:31.884; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg0210593337 T -> C LOC_Os02g18250-LOC_Os02g18260 intergenic_region ; MODIFIER silent_mutation Average:31.884; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0210593337 NA 5.62E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593337 NA 7.00E-06 mr1863 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593337 NA 7.54E-06 mr1901 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593337 5.94E-07 2.03E-08 mr1901 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251