Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0210593337:

Variant ID: vg0210593337 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 10593337
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.14, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

CGTTGTGACCTCTGCTCCTGCGATTGGATCCTGCGCCGGCGATGCTGAGGCTTGGCTGGTGATAATCTTGAGATCGAAGATGGGGAACTCGGCTGCCAGT[T/C]
GGCGTGCGGACGCTTGCGGAGTTAACCGGGACCGAGGCAGTAATCATGGTCTTGGTCTGGTTCAAGATGTTGACGACGTGATCAGCTTGGTTGAGCGCAT

Reverse complement sequence

ATGCGCTCAACCAAGCTGATCACGTCGTCAACATCTTGAACCAGACCAAGACCATGATTACTGCCTCGGTCCCGGTTAACTCCGCAAGCGTCCGCACGCC[A/G]
ACTGGCAGCCGAGTTCCCCATCTTCGATCTCAAGATTATCACCAGCCAAGCCTCAGCATCGCCGGCGCAGGATCCAATCGCAGGAGCAGAGGTCACAACG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.60%	20.80%	1.35%	24.16%	NA
All Indica	2759	27.10%	29.90%	2.32%	40.63%	NA
All Japonica	1512	98.90%	0.70%	0.00%	0.46%	NA
Aus	269	50.20%	49.80%	0.00%	0.00%	NA
Indica I	595	34.10%	33.60%	1.68%	30.59%	NA
Indica II	465	14.40%	38.90%	2.15%	44.52%	NA
Indica III	913	33.70%	18.60%	2.52%	45.13%	NA
Indica Intermediate	786	21.80%	34.90%	2.67%	40.71%	NA
Temperate Japonica	767	99.00%	0.90%	0.00%	0.13%	NA
Tropical Japonica	504	98.80%	0.20%	0.00%	0.99%	NA
Japonica Intermediate	241	98.80%	0.80%	0.00%	0.41%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	67.80%	16.70%	0.00%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0210593337	T -> DEL	N	N	silent_mutation	Average:31.884; most accessible tissue: Zhenshan97 flag leaf, score: 74.825	N	N	N	N
vg0210593337	T -> C	LOC_Os02g18240.1	upstream_gene_variant ; 3384.0bp to feature; MODIFIER	silent_mutation	Average:31.884; most accessible tissue: Zhenshan97 flag leaf, score: 74.825	N	N	N	N
vg0210593337	T -> C	LOC_Os02g18250.1	downstream_gene_variant ; 1486.0bp to feature; MODIFIER	silent_mutation	Average:31.884; most accessible tissue: Zhenshan97 flag leaf, score: 74.825	N	N	N	N
vg0210593337	T -> C	LOC_Os02g18260.1	downstream_gene_variant ; 231.0bp to feature; MODIFIER	silent_mutation	Average:31.884; most accessible tissue: Zhenshan97 flag leaf, score: 74.825	N	N	N	N
vg0210593337	T -> C	LOC_Os02g18270.1	downstream_gene_variant ; 2065.0bp to feature; MODIFIER	silent_mutation	Average:31.884; most accessible tissue: Zhenshan97 flag leaf, score: 74.825	N	N	N	N
vg0210593337	T -> C	LOC_Os02g18250-LOC_Os02g18260	intergenic_region ; MODIFIER	silent_mutation	Average:31.884; most accessible tissue: Zhenshan97 flag leaf, score: 74.825	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0210593337	NA	5.62E-06	mr1508	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593337	NA	7.00E-06	mr1863	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593337	NA	7.54E-06	mr1901	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593337	5.94E-07	2.03E-08	mr1901	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251