Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0210593156:

Variant ID: vg0210593156 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 10593156
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCAGCGACTCCATCCACGTCGTCGTCGTAGCGATCCGGTGAATGGTGGCGGGCGTAGCCTCATGCTGCACAGCGCTGGTTGATTGTATCACGGAGATCGA[T/C]
GGGGCGCCTACGAGGTGGGGAGCGAGGCCGTTCAACTTGACGCTCCCTGTGTCGTTCGGGAGGCGAGTGGACAGATCGCTCGTTGTGACCTCTGCTCCTG

Reverse complement sequence

CAGGAGCAGAGGTCACAACGAGCGATCTGTCCACTCGCCTCCCGAACGACACAGGGAGCGTCAAGTTGAACGGCCTCGCTCCCCACCTCGTAGGCGCCCC[A/G]
TCGATCTCCGTGATACAATCAACCAGCGCTGTGCAGCATGAGGCTACGCCCGCCACCATTCACCGGATCGCTACGACGACGACGTGGATGGAGTCGCTGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.10%	10.40%	3.43%	24.10%	NA
All Indica	2759	56.20%	0.80%	2.75%	40.20%	NA
All Japonica	1512	64.60%	30.00%	4.89%	0.46%	NA
Aus	269	92.60%	0.70%	2.60%	4.09%	NA
Indica I	595	64.20%	3.00%	4.37%	28.40%	NA
Indica II	465	52.30%	0.40%	2.37%	44.95%	NA
Indica III	913	53.10%	0.00%	0.77%	46.11%	NA
Indica Intermediate	786	56.10%	0.40%	4.07%	39.44%	NA
Temperate Japonica	767	42.10%	50.80%	6.91%	0.13%	NA
Tropical Japonica	504	94.20%	3.20%	1.59%	0.99%	NA
Japonica Intermediate	241	74.30%	19.90%	5.39%	0.41%	NA
VI/Aromatic	96	97.90%	1.00%	1.04%	0.00%	NA
Intermediate	90	71.10%	11.10%	4.44%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0210593156	T -> DEL	N	N	silent_mutation	Average:33.923; most accessible tissue: Zhenshan97 flag leaf, score: 75.761	N	N	N	N
vg0210593156	T -> C	LOC_Os02g18240.1	upstream_gene_variant ; 3203.0bp to feature; MODIFIER	silent_mutation	Average:33.923; most accessible tissue: Zhenshan97 flag leaf, score: 75.761	N	N	N	N
vg0210593156	T -> C	LOC_Os02g18250.1	downstream_gene_variant ; 1305.0bp to feature; MODIFIER	silent_mutation	Average:33.923; most accessible tissue: Zhenshan97 flag leaf, score: 75.761	N	N	N	N
vg0210593156	T -> C	LOC_Os02g18260.1	downstream_gene_variant ; 412.0bp to feature; MODIFIER	silent_mutation	Average:33.923; most accessible tissue: Zhenshan97 flag leaf, score: 75.761	N	N	N	N
vg0210593156	T -> C	LOC_Os02g18270.1	downstream_gene_variant ; 2246.0bp to feature; MODIFIER	silent_mutation	Average:33.923; most accessible tissue: Zhenshan97 flag leaf, score: 75.761	N	N	N	N
vg0210593156	T -> C	LOC_Os02g18250-LOC_Os02g18260	intergenic_region ; MODIFIER	silent_mutation	Average:33.923; most accessible tissue: Zhenshan97 flag leaf, score: 75.761	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0210593156	NA	6.96E-20	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0210593156	NA	2.12E-19	Heading_date	Jap_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0210593156	NA	1.78E-11	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0210593156	NA	2.33E-14	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0210593156	NA	1.30E-12	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156	NA	2.84E-07	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156	NA	5.34E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156	NA	9.35E-06	mr1544	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156	NA	7.42E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156	NA	1.34E-06	mr1896	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156	NA	5.05E-11	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156	NA	1.38E-07	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156	NA	1.53E-08	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156	NA	9.72E-07	mr1030_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156	NA	6.44E-07	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156	NA	5.38E-08	mr1549_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156	NA	3.38E-07	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156	NA	6.83E-06	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156	NA	7.23E-07	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156	NA	4.15E-08	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156	NA	4.15E-07	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156	NA	3.31E-06	mr1792_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156	NA	2.33E-11	mr1879_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251