\
| Variant ID: vg0210593156 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 10593156 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCAGCGACTCCATCCACGTCGTCGTCGTAGCGATCCGGTGAATGGTGGCGGGCGTAGCCTCATGCTGCACAGCGCTGGTTGATTGTATCACGGAGATCGA[T/C]
GGGGCGCCTACGAGGTGGGGAGCGAGGCCGTTCAACTTGACGCTCCCTGTGTCGTTCGGGAGGCGAGTGGACAGATCGCTCGTTGTGACCTCTGCTCCTG
CAGGAGCAGAGGTCACAACGAGCGATCTGTCCACTCGCCTCCCGAACGACACAGGGAGCGTCAAGTTGAACGGCCTCGCTCCCCACCTCGTAGGCGCCCC[A/G]
TCGATCTCCGTGATACAATCAACCAGCGCTGTGCAGCATGAGGCTACGCCCGCCACCATTCACCGGATCGCTACGACGACGACGTGGATGGAGTCGCTGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.10% | 10.40% | 3.43% | 24.10% | NA |
| All Indica | 2759 | 56.20% | 0.80% | 2.75% | 40.20% | NA |
| All Japonica | 1512 | 64.60% | 30.00% | 4.89% | 0.46% | NA |
| Aus | 269 | 92.60% | 0.70% | 2.60% | 4.09% | NA |
| Indica I | 595 | 64.20% | 3.00% | 4.37% | 28.40% | NA |
| Indica II | 465 | 52.30% | 0.40% | 2.37% | 44.95% | NA |
| Indica III | 913 | 53.10% | 0.00% | 0.77% | 46.11% | NA |
| Indica Intermediate | 786 | 56.10% | 0.40% | 4.07% | 39.44% | NA |
| Temperate Japonica | 767 | 42.10% | 50.80% | 6.91% | 0.13% | NA |
| Tropical Japonica | 504 | 94.20% | 3.20% | 1.59% | 0.99% | NA |
| Japonica Intermediate | 241 | 74.30% | 19.90% | 5.39% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 11.10% | 4.44% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0210593156 | T -> DEL | N | N | silent_mutation | Average:33.923; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 | N | N | N | N |
| vg0210593156 | T -> C | LOC_Os02g18240.1 | upstream_gene_variant ; 3203.0bp to feature; MODIFIER | silent_mutation | Average:33.923; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 | N | N | N | N |
| vg0210593156 | T -> C | LOC_Os02g18250.1 | downstream_gene_variant ; 1305.0bp to feature; MODIFIER | silent_mutation | Average:33.923; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 | N | N | N | N |
| vg0210593156 | T -> C | LOC_Os02g18260.1 | downstream_gene_variant ; 412.0bp to feature; MODIFIER | silent_mutation | Average:33.923; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 | N | N | N | N |
| vg0210593156 | T -> C | LOC_Os02g18270.1 | downstream_gene_variant ; 2246.0bp to feature; MODIFIER | silent_mutation | Average:33.923; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 | N | N | N | N |
| vg0210593156 | T -> C | LOC_Os02g18250-LOC_Os02g18260 | intergenic_region ; MODIFIER | silent_mutation | Average:33.923; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0210593156 | NA | 6.96E-20 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0210593156 | NA | 2.12E-19 | Heading_date | Jap_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0210593156 | NA | 1.78E-11 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0210593156 | NA | 2.33E-14 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0210593156 | NA | 1.30E-12 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210593156 | NA | 2.84E-07 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210593156 | NA | 5.34E-06 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210593156 | NA | 9.35E-06 | mr1544 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210593156 | NA | 7.42E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210593156 | NA | 1.34E-06 | mr1896 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210593156 | NA | 5.05E-11 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210593156 | NA | 1.38E-07 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210593156 | NA | 1.53E-08 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210593156 | NA | 9.72E-07 | mr1030_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210593156 | NA | 6.44E-07 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210593156 | NA | 5.38E-08 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210593156 | NA | 3.38E-07 | mr1577_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210593156 | NA | 6.83E-06 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210593156 | NA | 7.23E-07 | mr1671_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210593156 | NA | 4.15E-08 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210593156 | NA | 4.15E-07 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210593156 | NA | 3.31E-06 | mr1792_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210593156 | NA | 2.33E-11 | mr1879_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |