\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0210593156:

Variant ID: vg0210593156 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 10593156
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAGCGACTCCATCCACGTCGTCGTCGTAGCGATCCGGTGAATGGTGGCGGGCGTAGCCTCATGCTGCACAGCGCTGGTTGATTGTATCACGGAGATCGA[T/C]
GGGGCGCCTACGAGGTGGGGAGCGAGGCCGTTCAACTTGACGCTCCCTGTGTCGTTCGGGAGGCGAGTGGACAGATCGCTCGTTGTGACCTCTGCTCCTG

Reverse complement sequence

CAGGAGCAGAGGTCACAACGAGCGATCTGTCCACTCGCCTCCCGAACGACACAGGGAGCGTCAAGTTGAACGGCCTCGCTCCCCACCTCGTAGGCGCCCC[A/G]
TCGATCTCCGTGATACAATCAACCAGCGCTGTGCAGCATGAGGCTACGCCCGCCACCATTCACCGGATCGCTACGACGACGACGTGGATGGAGTCGCTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.10% 10.40% 3.43% 24.10% NA
All Indica  2759 56.20% 0.80% 2.75% 40.20% NA
All Japonica  1512 64.60% 30.00% 4.89% 0.46% NA
Aus  269 92.60% 0.70% 2.60% 4.09% NA
Indica I  595 64.20% 3.00% 4.37% 28.40% NA
Indica II  465 52.30% 0.40% 2.37% 44.95% NA
Indica III  913 53.10% 0.00% 0.77% 46.11% NA
Indica Intermediate  786 56.10% 0.40% 4.07% 39.44% NA
Temperate Japonica  767 42.10% 50.80% 6.91% 0.13% NA
Tropical Japonica  504 94.20% 3.20% 1.59% 0.99% NA
Japonica Intermediate  241 74.30% 19.90% 5.39% 0.41% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 71.10% 11.10% 4.44% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0210593156 T -> DEL N N silent_mutation Average:33.923; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 N N N N
vg0210593156 T -> C LOC_Os02g18240.1 upstream_gene_variant ; 3203.0bp to feature; MODIFIER silent_mutation Average:33.923; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 N N N N
vg0210593156 T -> C LOC_Os02g18250.1 downstream_gene_variant ; 1305.0bp to feature; MODIFIER silent_mutation Average:33.923; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 N N N N
vg0210593156 T -> C LOC_Os02g18260.1 downstream_gene_variant ; 412.0bp to feature; MODIFIER silent_mutation Average:33.923; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 N N N N
vg0210593156 T -> C LOC_Os02g18270.1 downstream_gene_variant ; 2246.0bp to feature; MODIFIER silent_mutation Average:33.923; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 N N N N
vg0210593156 T -> C LOC_Os02g18250-LOC_Os02g18260 intergenic_region ; MODIFIER silent_mutation Average:33.923; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0210593156 NA 6.96E-20 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0210593156 NA 2.12E-19 Heading_date Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0210593156 NA 1.78E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0210593156 NA 2.33E-14 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0210593156 NA 1.30E-12 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156 NA 2.84E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156 NA 5.34E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156 NA 9.35E-06 mr1544 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156 NA 7.42E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156 NA 1.34E-06 mr1896 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156 NA 5.05E-11 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156 NA 1.38E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156 NA 1.53E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156 NA 9.72E-07 mr1030_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156 NA 6.44E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156 NA 5.38E-08 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156 NA 3.38E-07 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156 NA 6.83E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156 NA 7.23E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156 NA 4.15E-08 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156 NA 4.15E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156 NA 3.31E-06 mr1792_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210593156 NA 2.33E-11 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251