\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0210471651:

Variant ID: vg0210471651 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 10471651
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACATGAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGT[T/G]
GGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATACTATGGCGCAAG

Reverse complement sequence

CTTGCGCCATAGTATAATGGCGTGGCTTGTGTCTCGTAGATGCGTCTCACCGTCTCCTCCAGGGTAGTCCAACTCGAGGTCCTCGTACGCGGCTTCCACC[A/C]
ACTCAACTTCGACCTTGGAGTATCCTGCTGGAATCGGCCTGCAGTGGTAAGTCCCTGAAGGGTCCGTTGGGATGGCCATGCCCGACGCCACCTTCATGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.20% 4.30% 4.46% 0.06% NA
All Indica  2759 87.60% 5.60% 6.74% 0.11% NA
All Japonica  1512 99.90% 0.00% 0.13% 0.00% NA
Aus  269 75.50% 17.10% 7.43% 0.00% NA
Indica I  595 88.70% 2.50% 8.24% 0.50% NA
Indica II  465 90.30% 3.40% 6.24% 0.00% NA
Indica III  913 88.10% 7.80% 4.16% 0.00% NA
Indica Intermediate  786 84.50% 6.60% 8.91% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 1.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0210471651 T -> G LOC_Os02g18040.1 missense_variant ; p.Leu1141Trp; MODERATE nonsynonymous_codon ; L1141W Average:33.611; most accessible tissue: Zhenshan97 flag leaf, score: 79.71 probably damaging 3.397 DELETERIOUS 0.00
vg0210471651 T -> DEL LOC_Os02g18040.1 N frameshift_variant Average:33.611; most accessible tissue: Zhenshan97 flag leaf, score: 79.71 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0210471651 T G -0.04 0.01 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0210471651 3.02E-09 1.68E-09 mr1113 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251