| Variant ID: vg0210316954 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 10316954 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTTATCATCAAAGAAACTATAATTTTAACTTATACTTTTACTTATTTATAATAAATTTTGGAATAACATGAACATCGGAGCCACCACCGACACCATGCAT[C/T]
AACTCAATTAGCTTGTCCGCCGCCAATTCGTAGTAGGGATTTAATTAGTGTTATGGCAGTGATTGAAAATAATTTTTTTATAGCAAATACATATATAATA
TATTATATATGTATTTGCTATAAAAAAATTATTTTCAATCACTGCCATAACACTAATTAAATCCCTACTACGAATTGGCGGCGGACAAGCTAATTGAGTT[G/A]
ATGCATGGTGTCGGTGGTGGCTCCGATGTTCATGTTATTCCAAAATTTATTATAAATAAGTAAAAGTATAAGTTAAAATTATAGTTTCTTTGATGATAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.00% | 2.10% | 0.91% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 91.10% | 6.20% | 2.65% | 0.00% | NA |
| Aus | 269 | 98.90% | 0.40% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.80% | 0.00% | 2.22% | 0.00% | NA |
| Tropical Japonica | 504 | 95.00% | 3.60% | 1.39% | 0.00% | NA |
| Japonica Intermediate | 241 | 61.80% | 31.50% | 6.64% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0210316954 | C -> T | LOC_Os02g17830.1 | upstream_gene_variant ; 1113.0bp to feature; MODIFIER | silent_mutation | Average:61.188; most accessible tissue: Callus, score: 88.505 | N | N | N | N |
| vg0210316954 | C -> T | LOC_Os02g17840.1 | downstream_gene_variant ; 2524.0bp to feature; MODIFIER | silent_mutation | Average:61.188; most accessible tissue: Callus, score: 88.505 | N | N | N | N |
| vg0210316954 | C -> T | LOC_Os02g17830-LOC_Os02g17840 | intergenic_region ; MODIFIER | silent_mutation | Average:61.188; most accessible tissue: Callus, score: 88.505 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0210316954 | NA | 1.03E-06 | mr1113 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210316954 | NA | 7.40E-08 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210316954 | NA | 1.50E-10 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210316954 | NA | 2.10E-10 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210316954 | 4.43E-06 | 5.07E-09 | mr1119 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210316954 | 9.22E-06 | 6.67E-08 | mr1120 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210316954 | 5.98E-06 | 1.14E-10 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210316954 | NA | 2.49E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210316954 | NA | 1.77E-07 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210316954 | NA | 3.28E-10 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/