\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0210298226:

Variant ID: vg0210298226 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 10298226
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAGTGAATTTAAACTGAAGTCCGAGAAACCGCCGCGCGTAACGGACCCAGAAATTTCCGGCGGGCATCTCTCTCTCCGTTCTTTGGAATTCGCACCGTC[G/A]
GAAATGTGTCTATTTAAGAGGATTTTGGGGATCCATTTTGAAGTCCGCCTGTTTGTGAAGAAAAACTCTCCAGCCTCCAAGCACTCCTCGTCTTCTCCGC

Reverse complement sequence

GCGGAGAAGACGAGGAGTGCTTGGAGGCTGGAGAGTTTTTCTTCACAAACAGGCGGACTTCAAAATGGATCCCCAAAATCCTCTTAAATAGACACATTTC[C/T]
GACGGTGCGAATTCCAAAGAACGGAGAGAGAGATGCCCGCCGGAAATTTCTGGGTCCGTTACGCGCGGCGGTTTCTCGGACTTCAGTTTAAATTCACTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.80% 10.70% 2.26% 39.15% NA
All Indica  2759 38.70% 0.10% 1.59% 59.55% NA
All Japonica  1512 62.70% 32.40% 3.44% 1.46% NA
Aus  269 43.10% 0.00% 0.74% 56.13% NA
Indica I  595 54.50% 0.00% 1.01% 44.54% NA
Indica II  465 30.80% 0.20% 3.23% 65.81% NA
Indica III  913 29.40% 0.00% 0.44% 70.21% NA
Indica Intermediate  786 42.40% 0.40% 2.42% 54.83% NA
Temperate Japonica  767 90.00% 6.00% 2.87% 1.17% NA
Tropical Japonica  504 21.00% 72.80% 3.97% 2.18% NA
Japonica Intermediate  241 63.10% 32.00% 4.15% 0.83% NA
VI/Aromatic  96 83.30% 5.20% 2.08% 9.38% NA
Intermediate  90 54.40% 10.00% 7.78% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0210298226 G -> A LOC_Os02g17790.1 upstream_gene_variant ; 4224.0bp to feature; MODIFIER silent_mutation Average:32.701; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg0210298226 G -> A LOC_Os02g17810.1 upstream_gene_variant ; 241.0bp to feature; MODIFIER silent_mutation Average:32.701; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg0210298226 G -> A LOC_Os02g17820.1 downstream_gene_variant ; 3709.0bp to feature; MODIFIER silent_mutation Average:32.701; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg0210298226 G -> A LOC_Os02g17790-LOC_Os02g17810 intergenic_region ; MODIFIER silent_mutation Average:32.701; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg0210298226 G -> DEL N N silent_mutation Average:32.701; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0210298226 NA 7.30E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210298226 NA 2.14E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210298226 NA 1.90E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210298226 4.13E-08 2.22E-18 mr1871 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210298226 NA 5.95E-09 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210298226 NA 2.40E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210298226 NA 1.24E-10 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210298226 NA 1.93E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210298226 NA 4.25E-11 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210298226 1.04E-07 6.54E-19 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210298226 4.40E-06 1.42E-11 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210298226 1.76E-08 5.64E-25 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210298226 NA 2.57E-09 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210298226 NA 2.78E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251