\
| Variant ID: vg0210234945 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 10234945 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 78. )
CCACGGTCTCTACTACCCGAGGTGTCCTGGCAAGGCACACTTCGTCGGGTACAGCGACAACGACCACGCCGGCGACATCGACACCAACAAGAGCACGAGC[A/G]
GGATTCTCTTCTTCCTCGGCAAGTGCCTCGTTAGCTGGCAGTCGGACAAGCAGCAAGTGGTGGCCCTGTCCAGCTACGAGGCCGAGTACATAGCGGCCTC
GAGGCCGCTATGTACTCGGCCTCGTAGCTGGACAGGGCCACCACTTGCTGCTTGTCCGACTGCCAGCTAACGAGGCACTTGCCGAGGAAGAAGAGAATCC[T/C]
GCTCGTGCTCTTGTTGGTGTCGATGTCGCCGGCGTGGTCGTTGTCGCTGTACCCGACGAAGTGTGCCTTGCCAGGACACCTCGGGTAGTAGAGACCGTGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.80% | 8.50% | 1.06% | 59.63% | NA |
| All Indica | 2759 | 3.30% | 1.20% | 1.56% | 93.91% | NA |
| All Japonica | 1512 | 74.30% | 23.90% | 0.07% | 1.65% | NA |
| Aus | 269 | 41.60% | 1.10% | 1.49% | 55.76% | NA |
| Indica I | 595 | 1.20% | 1.70% | 1.01% | 96.13% | NA |
| Indica II | 465 | 3.20% | 1.50% | 0.86% | 94.41% | NA |
| Indica III | 913 | 4.20% | 0.50% | 2.52% | 92.77% | NA |
| Indica Intermediate | 786 | 4.10% | 1.40% | 1.27% | 93.26% | NA |
| Temperate Japonica | 767 | 53.30% | 45.40% | 0.13% | 1.17% | NA |
| Tropical Japonica | 504 | 97.20% | 0.20% | 0.00% | 2.58% | NA |
| Japonica Intermediate | 241 | 93.40% | 5.40% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 90.60% | 0.00% | 0.00% | 9.38% | NA |
| Intermediate | 90 | 44.40% | 5.60% | 2.22% | 47.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0210234945 | A -> G | LOC_Os02g17720.1 | missense_variant ; p.Arg1356Gly; MODERATE | nonsynonymous_codon ; R1356G | Average:15.767; most accessible tissue: Callus, score: 28.821 | benign |
-0.931 |
TOLERATED | 1.00 |
| vg0210234945 | A -> DEL | LOC_Os02g17720.1 | N | frameshift_variant | Average:15.767; most accessible tissue: Callus, score: 28.821 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0210234945 | NA | 4.88E-08 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210234945 | NA | 1.00E-11 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210234945 | NA | 1.21E-09 | mr1398_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210234945 | NA | 1.19E-08 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210234945 | 4.92E-06 | 4.47E-19 | mr1581_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210234945 | NA | 1.58E-07 | mr1852_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210234945 | NA | 1.71E-08 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |