Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0210216171:

Variant ID: vg0210216171 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 10216171
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.02, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


GATGTTACATGAGAAAAGTGTAATGTTTGTCACAACTAGGATGGCATCACGCTCATGGCCACGGCGCACCTTGTAGCTGCAGTATATGCCTGACCAGTTG[C/A]
ATGGGCTGGTTGCGTTGCTCCATTCCTCTAGCCCGCAGTAGGAGAGATCGCCCCTTAGACCAGATTTCCATTGGAGAAGTGCTTCAGCTTGGCGATCCAA

Reverse complement sequence

TTGGATCGCCAAGCTGAAGCACTTCTCCAATGGAAATCTGGTCTAAGGGGCGATCTCTCCTACTGCGGGCTAGAGGAATGGAGCAACGCAACCAGCCCAT[G/T]
CAACTGGTCAGGCATATACTGCAGCTACAAGGTGCGCCGTGGCCATGAGCGTGATGCCATCCTAGTTGTGACAAACATTACACTTTTCTCATGTAACATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.70% 31.20% 0.08% 0.00% NA
All Indica  2759 97.10% 2.80% 0.07% 0.00% NA
All Japonica  1512 23.10% 76.70% 0.13% 0.00% NA
Aus  269 58.70% 41.30% 0.00% 0.00% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 97.60% 2.20% 0.22% 0.00% NA
Indica III  913 96.20% 3.70% 0.11% 0.00% NA
Indica Intermediate  786 96.40% 3.60% 0.00% 0.00% NA
Temperate Japonica  767 42.00% 57.80% 0.26% 0.00% NA
Tropical Japonica  504 2.60% 97.40% 0.00% 0.00% NA
Japonica Intermediate  241 6.20% 93.80% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 57.80% 42.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0210216171 C -> A LOC_Os02g17710.1 missense_variant ; p.Cys64Phe; MODERATE nonsynonymous_codon ; C64F Average:90.215; most accessible tissue: Zhenshan97 panicle, score: 95.081 probably damaging 2.149 DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0210216171 C A -0.02 0.0 -0.01 -0.02 -0.02 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0210216171 NA 2.10E-09 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210216171 NA 1.82E-09 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210216171 NA 8.26E-09 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210216171 NA 3.35E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210216171 NA 2.21E-14 mr1379_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210216171 NA 3.36E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210216171 NA 6.00E-10 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210216171 NA 6.59E-19 mr1581_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210216171 NA 6.35E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251