\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0210196586:

Variant ID: vg0210196586 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 10196586
Reference Allele: TAlternative Allele: C,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCCGGTTAGTAACTCCAACCGGGACTAAAGATCCATTTTTAGTCCCGGTTATTTCAACCGGGACTAAAAATGGGTATTTTTAGTCCCGGATTCGTAGTC[T/C,A]
CGGTTGCATAACCGGGACTATAGGGGGTTGTGAACTGGGACTAAAAAAGGTTTGTCCACCAGTGTACAATAATTTAAGCTTTCAGTTATTTTTCTAAGCA

Reverse complement sequence

TGCTTAGAAAAATAACTGAAAGCTTAAATTATTGTACACTGGTGGACAAACCTTTTTTAGTCCCAGTTCACAACCCCCTATAGTCCCGGTTATGCAACCG[A/G,T]
GACTACGAATCCGGGACTAAAAATACCCATTTTTAGTCCCGGTTGAAATAACCGGGACTAAAAATGGATCTTTAGTCCCGGTTGGAGTTACTAACCGGGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.60% 0.50% 3.68% 27.99% A: 0.15%
All Indica  2759 46.90% 0.70% 5.62% 46.68% A: 0.14%
All Japonica  1512 98.90% 0.00% 0.00% 0.99% A: 0.07%
Aus  269 91.40% 1.10% 6.69% 0.00% A: 0.74%
Indica I  595 62.90% 0.20% 2.18% 34.79% NA
Indica II  465 26.00% 0.00% 4.52% 69.25% A: 0.22%
Indica III  913 40.70% 1.40% 8.54% 48.96% A: 0.33%
Indica Intermediate  786 54.20% 0.60% 5.47% 39.69% NA
Temperate Japonica  767 99.10% 0.00% 0.00% 0.91% NA
Tropical Japonica  504 98.40% 0.00% 0.00% 1.39% A: 0.20%
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 74.40% 2.20% 1.11% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0210196586 T -> A LOC_Os02g17690.1 upstream_gene_variant ; 743.0bp to feature; MODIFIER silent_mutation Average:42.829; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0210196586 T -> A LOC_Os02g17680-LOC_Os02g17690 intergenic_region ; MODIFIER silent_mutation Average:42.829; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0210196586 T -> DEL N N silent_mutation Average:42.829; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0210196586 T -> C LOC_Os02g17690.1 upstream_gene_variant ; 743.0bp to feature; MODIFIER silent_mutation Average:42.829; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0210196586 T -> C LOC_Os02g17680-LOC_Os02g17690 intergenic_region ; MODIFIER silent_mutation Average:42.829; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0210196586 NA 1.62E-08 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210196586 NA 5.51E-07 mr1654 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210196586 NA 1.52E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251