Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0210196586:

Variant ID: vg0210196586 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 10196586
Reference Allele: T	Alternative Allele: C,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCCGGTTAGTAACTCCAACCGGGACTAAAGATCCATTTTTAGTCCCGGTTATTTCAACCGGGACTAAAAATGGGTATTTTTAGTCCCGGATTCGTAGTC[T/C,A]
CGGTTGCATAACCGGGACTATAGGGGGTTGTGAACTGGGACTAAAAAAGGTTTGTCCACCAGTGTACAATAATTTAAGCTTTCAGTTATTTTTCTAAGCA

Reverse complement sequence

TGCTTAGAAAAATAACTGAAAGCTTAAATTATTGTACACTGGTGGACAAACCTTTTTTAGTCCCAGTTCACAACCCCCTATAGTCCCGGTTATGCAACCG[A/G,T]
GACTACGAATCCGGGACTAAAAATACCCATTTTTAGTCCCGGTTGAAATAACCGGGACTAAAAATGGATCTTTAGTCCCGGTTGGAGTTACTAACCGGGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.60%	0.50%	3.68%	27.99%	A: 0.15%
All Indica	2759	46.90%	0.70%	5.62%	46.68%	A: 0.14%
All Japonica	1512	98.90%	0.00%	0.00%	0.99%	A: 0.07%
Aus	269	91.40%	1.10%	6.69%	0.00%	A: 0.74%
Indica I	595	62.90%	0.20%	2.18%	34.79%	NA
Indica II	465	26.00%	0.00%	4.52%	69.25%	A: 0.22%
Indica III	913	40.70%	1.40%	8.54%	48.96%	A: 0.33%
Indica Intermediate	786	54.20%	0.60%	5.47%	39.69%	NA
Temperate Japonica	767	99.10%	0.00%	0.00%	0.91%	NA
Tropical Japonica	504	98.40%	0.00%	0.00%	1.39%	A: 0.20%
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	74.40%	2.20%	1.11%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0210196586	T -> A	LOC_Os02g17690.1	upstream_gene_variant ; 743.0bp to feature; MODIFIER	silent_mutation	Average:42.829; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0210196586	T -> A	LOC_Os02g17680-LOC_Os02g17690	intergenic_region ; MODIFIER	silent_mutation	Average:42.829; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0210196586	T -> DEL	N	N	silent_mutation	Average:42.829; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0210196586	T -> C	LOC_Os02g17690.1	upstream_gene_variant ; 743.0bp to feature; MODIFIER	silent_mutation	Average:42.829; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0210196586	T -> C	LOC_Os02g17680-LOC_Os02g17690	intergenic_region ; MODIFIER	silent_mutation	Average:42.829; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0210196586	NA	1.62E-08	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210196586	NA	5.51E-07	mr1654	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210196586	NA	1.52E-06	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251