\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0210098817:

Variant ID: vg0210098817 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 10098817
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


CATGTTCTCTGTTACTGCAAATTTCATCATGTTGTTACTGCCAAAAGAGTCAGTAACAATCTATAAATTTTGTAGTAACAACCTATAAATTGTGCAATAA[C/T]
GTATCATGTTACTACCCTTTTGGGATAATGTTACTACGAAATCATAGTATCAATGTATGATTCTTACAGTAACATAACTAATTTGTTTTCACATAATTTT

Reverse complement sequence

AAAATTATGTGAAAACAAATTAGTTATGTTACTGTAAGAATCATACATTGATACTATGATTTCGTAGTAACATTATCCCAAAAGGGTAGTAACATGATAC[G/A]
TTATTGCACAATTTATAGGTTGTTACTACAAAATTTATAGATTGTTACTGACTCTTTTGGCAGTAACAACATGATGAAATTTGCAGTAACAGAGAACATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.20% 2.20% 1.67% 2.96% NA
All Indica  2759 89.10% 3.80% 2.86% 4.31% NA
All Japonica  1512 99.00% 0.00% 0.00% 0.99% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.70% 0.70% 0.17% 0.50% NA
Indica II  465 91.80% 1.10% 0.86% 6.24% NA
Indica III  913 82.60% 2.80% 7.45% 7.12% NA
Indica Intermediate  786 87.70% 8.80% 0.76% 2.80% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 97.80% 0.00% 0.00% 2.18% NA
Japonica Intermediate  241 99.20% 0.00% 0.00% 0.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 0.00% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0210098817 C -> T LOC_Os02g17534.1 upstream_gene_variant ; 3624.0bp to feature; MODIFIER silent_mutation Average:34.648; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 N N N N
vg0210098817 C -> T LOC_Os02g17550.1 upstream_gene_variant ; 1739.0bp to feature; MODIFIER silent_mutation Average:34.648; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 N N N N
vg0210098817 C -> T LOC_Os02g17534-LOC_Os02g17550 intergenic_region ; MODIFIER silent_mutation Average:34.648; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 N N N N
vg0210098817 C -> DEL N N silent_mutation Average:34.648; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0210098817 NA 8.07E-09 mr1125 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210098817 NA 2.23E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210098817 NA 3.21E-07 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210098817 NA 1.72E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210098817 NA 6.37E-07 mr1125_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210098817 NA 8.93E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210098817 NA 9.71E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251