Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0210098817:

Variant ID: vg0210098817 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 10098817
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

CATGTTCTCTGTTACTGCAAATTTCATCATGTTGTTACTGCCAAAAGAGTCAGTAACAATCTATAAATTTTGTAGTAACAACCTATAAATTGTGCAATAA[C/T]
GTATCATGTTACTACCCTTTTGGGATAATGTTACTACGAAATCATAGTATCAATGTATGATTCTTACAGTAACATAACTAATTTGTTTTCACATAATTTT

Reverse complement sequence

AAAATTATGTGAAAACAAATTAGTTATGTTACTGTAAGAATCATACATTGATACTATGATTTCGTAGTAACATTATCCCAAAAGGGTAGTAACATGATAC[G/A]
TTATTGCACAATTTATAGGTTGTTACTACAAAATTTATAGATTGTTACTGACTCTTTTGGCAGTAACAACATGATGAAATTTGCAGTAACAGAGAACATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.20%	2.20%	1.67%	2.96%	NA
All Indica	2759	89.10%	3.80%	2.86%	4.31%	NA
All Japonica	1512	99.00%	0.00%	0.00%	0.99%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.70%	0.70%	0.17%	0.50%	NA
Indica II	465	91.80%	1.10%	0.86%	6.24%	NA
Indica III	913	82.60%	2.80%	7.45%	7.12%	NA
Indica Intermediate	786	87.70%	8.80%	0.76%	2.80%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	97.80%	0.00%	0.00%	2.18%	NA
Japonica Intermediate	241	99.20%	0.00%	0.00%	0.83%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	0.00%	0.00%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0210098817	C -> T	LOC_Os02g17534.1	upstream_gene_variant ; 3624.0bp to feature; MODIFIER	silent_mutation	Average:34.648; most accessible tissue: Zhenshan97 flag leaf, score: 66.824	N	N	N	N
vg0210098817	C -> T	LOC_Os02g17550.1	upstream_gene_variant ; 1739.0bp to feature; MODIFIER	silent_mutation	Average:34.648; most accessible tissue: Zhenshan97 flag leaf, score: 66.824	N	N	N	N
vg0210098817	C -> T	LOC_Os02g17534-LOC_Os02g17550	intergenic_region ; MODIFIER	silent_mutation	Average:34.648; most accessible tissue: Zhenshan97 flag leaf, score: 66.824	N	N	N	N
vg0210098817	C -> DEL	N	N	silent_mutation	Average:34.648; most accessible tissue: Zhenshan97 flag leaf, score: 66.824	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0210098817	NA	8.07E-09	mr1125	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210098817	NA	2.23E-06	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210098817	NA	3.21E-07	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210098817	NA	1.72E-06	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210098817	NA	6.37E-07	mr1125_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210098817	NA	8.93E-06	mr1422_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210098817	NA	9.71E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251