| Variant ID: vg0210098817 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 10098817 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 250. )
CATGTTCTCTGTTACTGCAAATTTCATCATGTTGTTACTGCCAAAAGAGTCAGTAACAATCTATAAATTTTGTAGTAACAACCTATAAATTGTGCAATAA[C/T]
GTATCATGTTACTACCCTTTTGGGATAATGTTACTACGAAATCATAGTATCAATGTATGATTCTTACAGTAACATAACTAATTTGTTTTCACATAATTTT
AAAATTATGTGAAAACAAATTAGTTATGTTACTGTAAGAATCATACATTGATACTATGATTTCGTAGTAACATTATCCCAAAAGGGTAGTAACATGATAC[G/A]
TTATTGCACAATTTATAGGTTGTTACTACAAAATTTATAGATTGTTACTGACTCTTTTGGCAGTAACAACATGATGAAATTTGCAGTAACAGAGAACATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.20% | 2.20% | 1.67% | 2.96% | NA |
| All Indica | 2759 | 89.10% | 3.80% | 2.86% | 4.31% | NA |
| All Japonica | 1512 | 99.00% | 0.00% | 0.00% | 0.99% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 0.70% | 0.17% | 0.50% | NA |
| Indica II | 465 | 91.80% | 1.10% | 0.86% | 6.24% | NA |
| Indica III | 913 | 82.60% | 2.80% | 7.45% | 7.12% | NA |
| Indica Intermediate | 786 | 87.70% | 8.80% | 0.76% | 2.80% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 97.80% | 0.00% | 0.00% | 2.18% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 0.00% | 0.00% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0210098817 | C -> T | LOC_Os02g17534.1 | upstream_gene_variant ; 3624.0bp to feature; MODIFIER | silent_mutation | Average:34.648; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 | N | N | N | N |
| vg0210098817 | C -> T | LOC_Os02g17550.1 | upstream_gene_variant ; 1739.0bp to feature; MODIFIER | silent_mutation | Average:34.648; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 | N | N | N | N |
| vg0210098817 | C -> T | LOC_Os02g17534-LOC_Os02g17550 | intergenic_region ; MODIFIER | silent_mutation | Average:34.648; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 | N | N | N | N |
| vg0210098817 | C -> DEL | N | N | silent_mutation | Average:34.648; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0210098817 | NA | 8.07E-09 | mr1125 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210098817 | NA | 2.23E-06 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210098817 | NA | 3.21E-07 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210098817 | NA | 1.72E-06 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210098817 | NA | 6.37E-07 | mr1125_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210098817 | NA | 8.93E-06 | mr1422_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210098817 | NA | 9.71E-07 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |