\
| Variant ID: vg0210071634 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 10071634 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCGGATTGTTATCAACATGTGAGTGTCTTTCCAGCCAGTCGAGGATGTAGTAGTGGCCAAGGACGGCGGGCGGACAGGCATTAGCGATGAGGCAGCAGAA[G/A]
CGCGTGCAGGCGAAGGTGACGAGGTGATGAAGCGGAGGAGGACGCACTATAGGAGGTCATCGATGTCGGTAGGAGTATCTTTTGGCTTCCATGCTTTTTC
GAAAAAGCATGGAAGCCAAAAGATACTCCTACCGACATCGATGACCTCCTATAGTGCGTCCTCCTCCGCTTCATCACCTCGTCACCTTCGCCTGCACGCG[C/T]
TTCTGCTGCCTCATCGCTAATGCCTGTCCGCCCGCCGTCCTTGGCCACTACTACATCCTCGACTGGCTGGAAAGACACTCACATGTTGATAACAATCCGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 91.20% | 8.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 40.50% | 59.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.20% | 12.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.70% | 4.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.00% | 6.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.40% | 11.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0210071634 | G -> A | LOC_Os02g17480.1 | upstream_gene_variant ; 4186.0bp to feature; MODIFIER | silent_mutation | Average:74.397; most accessible tissue: Zhenshan97 flag leaf, score: 84.295 | N | N | N | N |
| vg0210071634 | G -> A | LOC_Os02g17500.1 | upstream_gene_variant ; 2947.0bp to feature; MODIFIER | silent_mutation | Average:74.397; most accessible tissue: Zhenshan97 flag leaf, score: 84.295 | N | N | N | N |
| vg0210071634 | G -> A | LOC_Os02g17500.3 | upstream_gene_variant ; 2947.0bp to feature; MODIFIER | silent_mutation | Average:74.397; most accessible tissue: Zhenshan97 flag leaf, score: 84.295 | N | N | N | N |
| vg0210071634 | G -> A | LOC_Os02g17500.2 | upstream_gene_variant ; 3379.0bp to feature; MODIFIER | silent_mutation | Average:74.397; most accessible tissue: Zhenshan97 flag leaf, score: 84.295 | N | N | N | N |
| vg0210071634 | G -> A | LOC_Os02g17490.1 | downstream_gene_variant ; 525.0bp to feature; MODIFIER | silent_mutation | Average:74.397; most accessible tissue: Zhenshan97 flag leaf, score: 84.295 | N | N | N | N |
| vg0210071634 | G -> A | LOC_Os02g17490-LOC_Os02g17500 | intergenic_region ; MODIFIER | silent_mutation | Average:74.397; most accessible tissue: Zhenshan97 flag leaf, score: 84.295 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0210071634 | NA | 1.76E-06 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210071634 | NA | 7.22E-06 | mr1186 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210071634 | NA | 1.22E-06 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210071634 | NA | 1.09E-07 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210071634 | NA | 8.71E-06 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210071634 | NA | 1.33E-07 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210071634 | NA | 6.93E-08 | mr1706 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210071634 | 2.82E-06 | 2.82E-06 | mr1863 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |