\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0210017956:

Variant ID: vg0210017956 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 10017956
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, A: 0.07, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CTCGCAATTTACACGCAAACTGTGTAATTAGTTTTTTTTTTATCAATATTTAATACTCTGTACATGTATTCAAACGTTCGATGTGACGAGACAAAAAAAA[T/A]
TGCCGGTGGATCTAAACACCCCCTTATTTTCCGTTGACTTGGCGTCTATCCCTTTTATATCCGAGACTTAGGGACTGTTCAGATTGATGTCATTTTCAAC

Reverse complement sequence

GTTGAAAATGACATCAATCTGAACAGTCCCTAAGTCTCGGATATAAAAGGGATAGACGCCAAGTCAACGGAAAATAAGGGGGTGTTTAGATCCACCGGCA[A/T]
TTTTTTTTGTCTCGTCACATCGAACGTTTGAATACATGTACAGAGTATTAAATATTGATAAAAAAAAAACTAATTACACAGTTTGCGTGTAAATTGCGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.70% 22.20% 0.15% 0.00% NA
All Indica  2759 62.70% 37.00% 0.22% 0.00% NA
All Japonica  1512 99.10% 0.80% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 44.00% 55.60% 0.34% 0.00% NA
Indica II  465 53.50% 46.00% 0.43% 0.00% NA
Indica III  913 87.20% 12.80% 0.00% 0.00% NA
Indica Intermediate  786 53.90% 45.80% 0.25% 0.00% NA
Temperate Japonica  767 98.70% 1.20% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0210017956 T -> A LOC_Os02g17400.1 upstream_gene_variant ; 4486.0bp to feature; MODIFIER silent_mutation Average:28.732; most accessible tissue: Callus, score: 50.363 N N N N
vg0210017956 T -> A LOC_Os02g17420.1 upstream_gene_variant ; 4040.0bp to feature; MODIFIER silent_mutation Average:28.732; most accessible tissue: Callus, score: 50.363 N N N N
vg0210017956 T -> A LOC_Os02g17410.1 downstream_gene_variant ; 999.0bp to feature; MODIFIER silent_mutation Average:28.732; most accessible tissue: Callus, score: 50.363 N N N N
vg0210017956 T -> A LOC_Os02g17410-LOC_Os02g17420 intergenic_region ; MODIFIER silent_mutation Average:28.732; most accessible tissue: Callus, score: 50.363 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0210017956 NA 2.62E-08 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210017956 NA 1.40E-07 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210017956 NA 1.64E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210017956 NA 5.87E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210017956 NA 9.56E-07 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210017956 NA 4.81E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210017956 NA 4.71E-13 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210017956 NA 1.07E-10 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210017956 NA 1.77E-11 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210017956 NA 2.44E-09 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210017956 NA 2.49E-08 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210017956 3.58E-06 1.53E-22 mr1255_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210017956 4.92E-07 1.49E-14 mr1255_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210017956 NA 7.75E-12 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210017956 NA 2.47E-09 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210017956 NA 1.66E-06 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210017956 NA 2.82E-09 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210017956 NA 1.59E-07 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210017956 NA 1.95E-11 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210017956 NA 1.35E-06 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210017956 NA 2.35E-08 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210017956 NA 9.86E-07 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251