Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0209662259:

Variant ID: vg0209662259 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 9662259
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TATAGAAATACAATTAAGAAAAAAAATAGAAATACGGAATTAAAAAATAAGGAATATTAGAAGTAGAGTATAGAGTCTATATAGAAATACAATTGTCAGG[G/A]
TTACGGGTCAGGCATACCCTCTACCCCTCGATATACGTTACATATCGACAAGACCTATCCACGTGTACACGGATAAATCCTTTGGCATCCAAGGAAACTC

Reverse complement sequence

GAGTTTCCTTGGATGCCAAAGGATTTATCCGTGTACACGTGGATAGGTCTTGTCGATATGTAACGTATATCGAGGGGTAGAGGGTATGCCTGACCCGTAA[C/T]
CCTGACAATTGTATTTCTATATAGACTCTATACTCTACTTCTAATATTCCTTATTTTTTAATTCCGTATTTCTATTTTTTTTCTTAATTGTATTTCTATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.90% 26.40% 1.71% 0.00% NA
All Indica  2759 57.00% 40.80% 2.17% 0.00% NA
All Japonica  1512 95.80% 3.40% 0.86% 0.00% NA
Aus  269 85.50% 13.40% 1.12% 0.00% NA
Indica I  595 58.20% 36.60% 5.21% 0.00% NA
Indica II  465 61.90% 35.70% 2.37% 0.00% NA
Indica III  913 51.80% 47.80% 0.44% 0.00% NA
Indica Intermediate  786 59.30% 38.90% 1.78% 0.00% NA
Temperate Japonica  767 97.00% 2.00% 1.04% 0.00% NA
Tropical Japonica  504 94.00% 5.40% 0.60% 0.00% NA
Japonica Intermediate  241 95.40% 3.70% 0.83% 0.00% NA
VI/Aromatic  96 79.20% 20.80% 0.00% 0.00% NA
Intermediate  90 76.70% 17.80% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0209662259 G -> A LOC_Os02g16950.1 upstream_gene_variant ; 718.0bp to feature; MODIFIER silent_mutation Average:58.549; most accessible tissue: Zhenshan97 root, score: 85.432 N N N N
vg0209662259 G -> A LOC_Os02g16940-LOC_Os02g16950 intergenic_region ; MODIFIER silent_mutation Average:58.549; most accessible tissue: Zhenshan97 root, score: 85.432 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0209662259 G A -0.04 -0.04 -0.03 -0.03 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0209662259 NA 7.08E-06 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209662259 NA 7.83E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209662259 7.08E-08 4.91E-07 mr1748_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251