Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0209482698:

Variant ID: vg0209482698 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 9482698
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

CGAGGGAAAGGCGTGATTCCTTGGAAGATTGGATTTAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGTGAAGATTG[C/T]
AGATCTTGAGTACAGGGTGTCGAGCTACGAGCTTAGCATGCAAGAAGAGGTGGCAAGGAAGGTGGATGAACGTATGGCCGCACATCGGTCCCAGGATCCC

Reverse complement sequence

GGGATCCTGGGACCGATGTGCGGCCATACGTTCATCCACCTTCCTTGCCACCTCTTCTTGCATGCTAAGCTCGTAGCTCGACACCCTGTACTCAAGATCT[G/A]
CAATCTTCACCTCGGTATCTCTCTTGCTCCTCATCCGACTCCTGTACGTGTGGATGTCCTCCTTAAATCCAATCTTCCAAGGAATCACGCCTTTCCCTCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.30%	26.70%	11.38%	0.55%	NA
All Indica	2759	78.30%	1.80%	19.03%	0.83%	NA
All Japonica	1512	27.00%	72.60%	0.26%	0.13%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	66.40%	0.70%	31.93%	1.01%	NA
Indica II	465	72.30%	3.20%	23.01%	1.51%	NA
Indica III	913	92.00%	1.40%	6.13%	0.44%	NA
Indica Intermediate	786	75.10%	2.30%	21.88%	0.76%	NA
Temperate Japonica	767	47.80%	51.50%	0.39%	0.26%	NA
Tropical Japonica	504	4.20%	95.80%	0.00%	0.00%	NA
Japonica Intermediate	241	8.30%	91.30%	0.41%	0.00%	NA
VI/Aromatic	96	14.60%	84.40%	1.04%	0.00%	NA
Intermediate	90	52.20%	37.80%	8.89%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0209482698	C -> T	LOC_Os02g16590.1	missense_variant ; p.Ala378Val; MODERATE	nonsynonymous_codon ; A378V	Average:19.847; most accessible tissue: Zhenshan97 flag leaf, score: 42.807	benign	0.399	TOLERATED	0.05
vg0209482698	C -> DEL	LOC_Os02g16590.1	N	frameshift_variant	Average:19.847; most accessible tissue: Zhenshan97 flag leaf, score: 42.807	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0209482698	NA	7.00E-11	mr1084	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	NA	5.51E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	NA	9.72E-07	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	NA	2.45E-12	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	NA	2.67E-11	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	NA	1.43E-08	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	1.00E-06	1.00E-06	mr1488	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	2.01E-06	3.04E-08	mr1492	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	NA	1.26E-12	mr1521	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	NA	4.40E-07	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	NA	1.93E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	NA	2.07E-06	mr1763	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	NA	4.00E-06	mr1773	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	NA	6.93E-11	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	NA	2.81E-06	mr1775	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	NA	3.38E-08	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	2.96E-06	2.96E-06	mr1779	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	NA	2.58E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	6.12E-06	6.12E-06	mr1797	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	NA	2.58E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	6.12E-06	6.12E-06	mr1801	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	8.38E-06	8.37E-06	mr1802	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	NA	3.30E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	NA	6.43E-06	mr1810	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	NA	1.09E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	NA	3.55E-06	mr1051_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	NA	4.91E-06	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	NA	6.34E-07	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209482698	NA	1.41E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251