\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0209427613:

Variant ID: vg0209427613 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 9427613
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


CCACCAATTAGTAGACTGATTAACTGAAAAAACAGTAGGTAAATTACCATACCCGCTTCCATCTCCAGTGTTGCCAATGGTCACATTAGCAGACTTAGAA[A/G]
TCTGCCCTGCAGGTGCCTTCATCCCCTTGCGCTGTGGACACTTCCTAGCCAGATGACCAGGTTGACCACACACAAAGCAAGTCCTCTCATCCTGATTAGG

Reverse complement sequence

CCTAATCAGGATGAGAGGACTTGCTTTGTGTGTGGTCAACCTGGTCATCTGGCTAGGAAGTGTCCACAGCGCAAGGGGATGAAGGCACCTGCAGGGCAGA[T/C]
TTCTAAGTCTGCTAATGTGACCATTGGCAACACTGGAGATGGAAGCGGGTATGGTAATTTACCTACTGTTTTTTCAGTTAATCAGTCTACTAATTGGTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.20% 7.80% 40.99% 14.03% NA
All Indica  2759 8.60% 8.60% 59.59% 23.20% NA
All Japonica  1512 91.50% 5.90% 1.98% 0.60% NA
Aus  269 3.30% 13.40% 81.04% 2.23% NA
Indica I  595 5.70% 4.50% 58.66% 31.09% NA
Indica II  465 4.70% 4.30% 56.13% 34.84% NA
Indica III  913 11.10% 14.10% 62.87% 11.94% NA
Indica Intermediate  786 10.20% 7.90% 58.52% 23.41% NA
Temperate Japonica  767 88.10% 10.00% 1.04% 0.78% NA
Tropical Japonica  504 96.00% 0.20% 3.57% 0.20% NA
Japonica Intermediate  241 92.90% 4.60% 1.66% 0.83% NA
VI/Aromatic  96 86.50% 3.10% 10.42% 0.00% NA
Intermediate  90 51.10% 1.10% 38.89% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0209427613 A -> G LOC_Os02g16520.1 missense_variant ; p.Ile237Thr; MODERATE nonsynonymous_codon ; I237T Average:24.379; most accessible tissue: Minghui63 panicle, score: 34.226 possibly damaging -1.851 TOLERATED 1.00
vg0209427613 A -> DEL LOC_Os02g16520.1 N frameshift_variant Average:24.379; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0209427613 NA 1.75E-07 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209427613 NA 5.58E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209427613 NA 6.03E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209427613 NA 9.79E-08 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209427613 NA 2.54E-09 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209427613 NA 8.11E-09 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209427613 NA 1.17E-06 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209427613 NA 2.81E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209427613 NA 1.27E-07 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209427613 5.47E-06 7.07E-08 mr1441 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209427613 NA 1.06E-08 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209427613 NA 6.12E-06 mr1743 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209427613 NA 5.25E-06 mr1785 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251