Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0209237133:

Variant ID: vg0209237133 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 9237133
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

CCTTTATGCTTCACCTTAAACTCGACCCACTTTCTCTCAAACTCTTCATGATCATATGGTGCGTGGACAAGTGCTCGAAAATCTGAAAGCATATCAGGAC[G/T,A]
AAGATGTCTTGCCATGTTCTGCTCAATGTGCCAAGTGCACAACCGATGCTCAGAATCCGGCATCACAGCTGCTATTGCTCTATGCATGGCATTGTCCCCA

Reverse complement sequence

TGGGGACAATGCCATGCATAGAGCAATAGCAGCTGTGATGCCGGATTCTGAGCATCGGTTGTGCACTTGGCACATTGAGCAGAACATGGCAAGACATCTT[C/A,T]
GTCCTGATATGCTTTCAGATTTTCGAGCACTTGTCCACGCACCATATGATCATGAAGAGTTTGAGAGAAAGTGGGTCGAGTTTAAGGTGAAGCATAAAGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.50%	7.40%	5.59%	5.92%	A: 0.63%
All Indica	2759	78.80%	11.20%	7.54%	1.63%	A: 0.83%
All Japonica	1512	82.60%	0.90%	2.25%	14.22%	A: 0.07%
Aus	269	86.20%	6.30%	4.83%	0.37%	A: 2.23%
Indica I	595	81.50%	10.40%	7.06%	1.01%	NA
Indica II	465	74.80%	9.00%	10.97%	1.72%	A: 3.44%
Indica III	913	78.10%	13.60%	5.48%	2.63%	A: 0.22%
Indica Intermediate	786	79.90%	10.30%	8.27%	0.89%	A: 0.64%
Temperate Japonica	767	85.40%	0.90%	2.48%	11.21%	NA
Tropical Japonica	504	81.90%	0.60%	1.59%	15.87%	NA
Japonica Intermediate	241	75.10%	1.20%	2.90%	20.33%	A: 0.41%
VI/Aromatic	96	79.20%	3.10%	2.08%	15.62%	NA
Intermediate	90	80.00%	7.80%	7.78%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0209237133	G -> A	LOC_Os02g16240.1	missense_variant ; p.Arg327Cys; MODERATE	nonsynonymous_codon ; R327C	Average:7.165; most accessible tissue: Zhenshan97 root, score: 16.934	probably damaging	2.628	DELETERIOUS	0.05
vg0209237133	G -> T	LOC_Os02g16240.1	missense_variant ; p.Arg327Ser; MODERATE	nonsynonymous_codon ; R327S	Average:7.165; most accessible tissue: Zhenshan97 root, score: 16.934	benign	-0.07	TOLERATED	0.22
vg0209237133	G -> DEL	LOC_Os02g16240.1	N	frameshift_variant	Average:7.165; most accessible tissue: Zhenshan97 root, score: 16.934	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0209237133	NA	2.51E-06	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	9.92E-09	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	6.89E-07	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	3.74E-06	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	7.30E-07	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	6.37E-07	mr1095	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	6.52E-06	mr1098	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	4.68E-06	mr1099	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	5.06E-06	mr1101	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	1.36E-07	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	8.92E-06	mr1150	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	3.51E-07	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	7.28E-09	NA	mr1183	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	4.65E-08	7.42E-11	mr1183	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	6.08E-07	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	4.57E-07	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	2.39E-07	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	3.36E-08	NA	mr1503	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	7.48E-08	3.36E-10	mr1503	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	8.16E-06	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	3.98E-07	mr1726	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	2.41E-06	mr1868	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	2.53E-07	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	1.17E-06	mr1929	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	3.39E-10	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	3.76E-09	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	7.22E-10	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	3.65E-06	mr1095_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	8.45E-06	mr1098_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	5.82E-06	mr1099_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	2.95E-08	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	1.84E-09	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	1.26E-06	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	8.93E-08	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	2.66E-06	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	6.37E-10	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	NA	3.55E-06	mr1795_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209237133	1.41E-06	8.06E-12	mr1861_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251