\
| Variant ID: vg0209233917 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 9233917 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCCCTTAACTTGGATAAACAGGAGAATAGCATATGCATAAAAATTCTGTGATGTTCTCTAAACAGGAGAAACATTGCAAGTAGTTACAATGATGTCTATC[T/A]
GAATCTTAGCCTAGAGCTAGTTGCCTTCATTTGCCTCGGTCACTAGGCGTTTAATATCTTGCTGCACTTCAATCACTTCGTTCATAGTAGAATTAATGAG
CTCATTAATTCTACTATGAACGAAGTGATTGAAGTGCAGCAAGATATTAAACGCCTAGTGACCGAGGCAAATGAAGGCAACTAGCTCTAGGCTAAGATTC[A/T]
GATAGACATCATTGTAACTACTTGCAATGTTTCTCCTGTTTAGAGAACATCACAGAATTTTTATGCATATGCTATTCTCCTGTTTATCCAAGTTAAGGGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.80% | 0.20% | 2.16% | 18.87% | NA |
| All Indica | 2759 | 65.40% | 0.30% | 3.59% | 30.74% | NA |
| All Japonica | 1512 | 98.10% | 0.00% | 0.07% | 1.79% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.00% | 0.37% | NA |
| Indica I | 595 | 64.90% | 0.00% | 1.85% | 33.28% | NA |
| Indica II | 465 | 63.40% | 0.40% | 3.44% | 32.69% | NA |
| Indica III | 913 | 69.30% | 0.30% | 4.93% | 25.41% | NA |
| Indica Intermediate | 786 | 62.50% | 0.30% | 3.44% | 33.84% | NA |
| Temperate Japonica | 767 | 98.20% | 0.00% | 0.00% | 1.83% | NA |
| Tropical Japonica | 504 | 98.00% | 0.00% | 0.20% | 1.79% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 0.00% | 2.22% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0209233917 | T -> A | LOC_Os02g16250.1 | upstream_gene_variant ; 4522.0bp to feature; MODIFIER | silent_mutation | Average:7.041; most accessible tissue: Callus, score: 29.807 | N | N | N | N |
| vg0209233917 | T -> A | LOC_Os02g16240.1 | downstream_gene_variant ; 17.0bp to feature; MODIFIER | silent_mutation | Average:7.041; most accessible tissue: Callus, score: 29.807 | N | N | N | N |
| vg0209233917 | T -> A | LOC_Os02g16230-LOC_Os02g16240 | intergenic_region ; MODIFIER | silent_mutation | Average:7.041; most accessible tissue: Callus, score: 29.807 | N | N | N | N |
| vg0209233917 | T -> DEL | N | N | silent_mutation | Average:7.041; most accessible tissue: Callus, score: 29.807 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0209233917 | 2.08E-06 | 3.28E-06 | mr1685 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209233917 | NA | 1.09E-06 | mr1706 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |