\
| Variant ID: vg0209228990 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 9228990 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TACCTTTGGTAGCATGGTTAATACCTACAGGTTTTAGACTTGGTATAGGTACCAACCAATATCACATAGGTACCAAGTACAAGGTATAACGTGCGTCACT[G/A]
CCGCTTGGGCAGGTGGTGAGCTGTCGACCACCAGCGTTTTGTCTCGTCTTCTCCCTTCTATTCCTTTCCAAATCTCCATGCCTTTTCTTCTCAATCTGGT
ACCAGATTGAGAAGAAAAGGCATGGAGATTTGGAAAGGAATAGAAGGGAGAAGACGAGACAAAACGCTGGTGGTCGACAGCTCACCACCTGCCCAAGCGG[C/T]
AGTGACGCACGTTATACCTTGTACTTGGTACCTATGTGATATTGGTTGGTACCTATACCAAGTCTAAAACCTGTAGGTATTAACCATGCTACCAAAGGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.30% | 1.20% | 1.10% | 55.40% | NA |
| All Indica | 2759 | 14.70% | 0.00% | 1.63% | 83.65% | NA |
| All Japonica | 1512 | 93.40% | 3.70% | 0.20% | 2.71% | NA |
| Aus | 269 | 15.60% | 0.00% | 0.37% | 84.01% | NA |
| Indica I | 595 | 27.70% | 0.00% | 3.70% | 68.57% | NA |
| Indica II | 465 | 20.00% | 0.00% | 0.65% | 79.35% | NA |
| Indica III | 913 | 3.60% | 0.00% | 0.77% | 95.62% | NA |
| Indica Intermediate | 786 | 14.60% | 0.00% | 1.65% | 83.72% | NA |
| Temperate Japonica | 767 | 91.80% | 6.00% | 0.39% | 1.83% | NA |
| Tropical Japonica | 504 | 96.00% | 0.00% | 0.00% | 3.97% | NA |
| Japonica Intermediate | 241 | 92.90% | 4.10% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 88.50% | 0.00% | 1.04% | 10.42% | NA |
| Intermediate | 90 | 61.10% | 0.00% | 2.22% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0209228990 | G -> A | LOC_Os02g16240.1 | downstream_gene_variant ; 4944.0bp to feature; MODIFIER | silent_mutation | Average:10.643; most accessible tissue: Callus, score: 53.164 | N | N | N | N |
| vg0209228990 | G -> A | LOC_Os02g16230-LOC_Os02g16240 | intergenic_region ; MODIFIER | silent_mutation | Average:10.643; most accessible tissue: Callus, score: 53.164 | N | N | N | N |
| vg0209228990 | G -> DEL | N | N | silent_mutation | Average:10.643; most accessible tissue: Callus, score: 53.164 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0209228990 | NA | 3.19E-06 | mr1057 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209228990 | NA | 1.47E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209228990 | NA | 8.36E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209228990 | NA | 7.08E-06 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209228990 | 2.70E-06 | 2.70E-06 | mr1166_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209228990 | 8.61E-09 | 8.51E-10 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209228990 | 7.07E-07 | 6.67E-09 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |