\
| Variant ID: vg0209219211 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 9219211 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCTCCACGTCCAGGGAATACAAGCTGATTGGTTGCTGGATTGAAATGCTCCATCAACCAGCTGCACAAATCAGGTCTGAGCTTCGAGCACTTGAGATCTA[C/T]
GAGGCCATGGAAGCCAGCCCCCTCTATTAGTCGCTTTTGTTCGCCACTCATATGGGGATACAACTTTATAAGTTTCATAGGTGAAGCCCTGCTACTTTCT
AGAAAGTAGCAGGGCTTCACCTATGAAACTTATAAAGTTGTATCCCCATATGAGTGGCGAACAAAAGCGACTAATAGAGGGGGCTGGCTTCCATGGCCTC[G/A]
TAGATCTCAAGTGCTCGAAGCTCAGACCTGATTTGTGCAGCTGGTTGATGGAGCATTTCAATCCAGCAACCAATCAGCTTGTATTCCCTGGACGTGGAGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.50% | 4.80% | 0.36% | 5.35% | NA |
| All Indica | 2759 | 87.60% | 7.90% | 0.43% | 4.02% | NA |
| All Japonica | 1512 | 99.00% | 0.10% | 0.00% | 0.86% | NA |
| Aus | 269 | 52.00% | 0.40% | 1.86% | 45.72% | NA |
| Indica I | 595 | 80.30% | 15.10% | 0.34% | 4.20% | NA |
| Indica II | 465 | 93.50% | 2.40% | 0.43% | 3.66% | NA |
| Indica III | 913 | 90.40% | 7.00% | 0.66% | 1.97% | NA |
| Indica Intermediate | 786 | 86.40% | 6.90% | 0.25% | 6.49% | NA |
| Temperate Japonica | 767 | 99.00% | 0.10% | 0.00% | 0.91% | NA |
| Tropical Japonica | 504 | 99.00% | 0.20% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 4.40% | 0.00% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0209219211 | C -> T | LOC_Os02g16220.1 | missense_variant ; p.Val211Ile; MODERATE | nonsynonymous_codon ; V211I | Average:17.45; most accessible tissue: Callus, score: 33.14 | benign |
1.156 |
DELETERIOUS | 0.00 |
| vg0209219211 | C -> DEL | LOC_Os02g16220.1 | N | frameshift_variant | Average:17.45; most accessible tissue: Callus, score: 33.14 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0209219211 | NA | 5.00E-10 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209219211 | NA | 1.24E-10 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209219211 | NA | 2.62E-07 | mr1219 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209219211 | NA | 2.92E-09 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209219211 | NA | 7.83E-09 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209219211 | NA | 1.13E-07 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209219211 | 3.25E-07 | 7.37E-13 | mr1201_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209219211 | 9.26E-08 | 3.17E-13 | mr1201_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209219211 | 3.46E-06 | 3.02E-09 | mr1219_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209219211 | 1.67E-07 | 3.16E-12 | mr1219_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209219211 | NA | 4.01E-06 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209219211 | NA | 6.39E-12 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209219211 | NA | 1.06E-11 | mr1274_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209219211 | NA | 1.75E-07 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209219211 | NA | 5.37E-06 | mr1901_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209219211 | NA | 1.99E-07 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |