Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0209217878:

Variant ID: vg0209217878 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 9217878
Reference Allele: AAAAG	Alternative Allele: TAAAG,A
Primary Allele: AAAAG	Secondary Allele: TAAAG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCAAGGCCGGAAATCTGTCTCACAAATTTCGTGACCAAACCTGAAAACCCTTCACACAAATTTTGCACAGCGATCACAATTCTGTCCTTTTCCTGTATA[AAAAG/TAAAG,A]
AAAAAACAGAGAAGTTACATATGCAGATTTCACAAAGTTACTTTTGCAGTTTGTTGATGTTACATTTACCAAGGGTACAAAAAGTAAAACAGAGAAGTGG

Reverse complement sequence

CCACTTCTCTGTTTTACTTTTTGTACCCTTGGTAAATGTAACATCAACAAACTGCAAAAGTAACTTTGTGAAATCTGCATATGTAACTTCTCTGTTTTTT[CTTTT/CTTTA,T]
TATACAGGAAAAGGACAGAATTGTGATCGCTGTGCAAAATTTGTGTGAAGGGTTTTCAGGTTTGGTCACGAAATTTGTGAGACAGATTTCCGGCCTTGAT

Allele Frequencies:

Populations	Population Size	Frequency of AAAAG(primary allele)	Frequency of TAAAG(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.90%	4.50%	0.91%	7.62%	NA
All Indica	2759	83.20%	7.50%	1.30%	7.97%	NA
All Japonica	1512	99.30%	0.10%	0.13%	0.40%	NA
Aus	269	50.20%	0.40%	1.12%	48.33%	NA
Indica I	595	81.70%	13.60%	1.01%	3.70%	NA
Indica II	465	85.60%	1.90%	1.08%	11.40%	NA
Indica III	913	84.80%	6.90%	0.88%	7.45%	NA
Indica Intermediate	786	81.20%	6.90%	2.16%	9.80%	NA
Temperate Japonica	767	99.30%	0.10%	0.00%	0.52%	NA
Tropical Japonica	504	99.20%	0.20%	0.20%	0.40%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	4.40%	2.22%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0209217878	AAAAG -> A	LOC_Os02g16210.1	downstream_gene_variant ; 3179.0bp to feature; MODIFIER	N	Average:14.671; most accessible tissue: Minghui63 flag leaf, score: 34.335	N	N	N	N
vg0209217878	AAAAG -> A	LOC_Os02g16220.1	intron_variant ; MODIFIER	N	Average:14.671; most accessible tissue: Minghui63 flag leaf, score: 34.335	N	N	N	N
vg0209217878	AAAAG -> TAAAG	LOC_Os02g16220.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:14.671; most accessible tissue: Minghui63 flag leaf, score: 34.335	N	N	N	N
vg0209217878	AAAAG -> TAAAG	LOC_Os02g16210.1	downstream_gene_variant ; 3178.0bp to feature; MODIFIER	silent_mutation	Average:14.671; most accessible tissue: Minghui63 flag leaf, score: 34.335	N	N	N	N
vg0209217878	AAAAG -> DEL	N	N	silent_mutation	Average:14.671; most accessible tissue: Minghui63 flag leaf, score: 34.335	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0209217878	NA	1.92E-07	mr1201	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209217878	NA	9.53E-08	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209217878	NA	5.73E-06	mr1219	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209217878	NA	2.68E-07	mr1219	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209217878	NA	9.11E-07	mr1274	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209217878	NA	9.91E-11	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209217878	5.41E-06	9.33E-11	mr1201_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209217878	NA	2.48E-08	mr1219_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209217878	1.11E-06	1.14E-10	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209217878	NA	2.24E-06	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209217878	NA	2.80E-11	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209217878	NA	6.33E-11	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209217878	NA	5.89E-07	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209217878	NA	3.74E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209217878	NA	1.03E-07	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209217878	1.96E-06	NA	mr1846_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209217878	NA	3.89E-06	mr1901_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209217878	NA	5.58E-07	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209217878	NA	7.12E-06	mr1930_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251