\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0209216559:

Variant ID: vg0209216559 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 9216559
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAGTAAAAAAGTACTGTGTACAGCAAAAAATATGTGATTGTACCTATTCCTTCTTGACTTGGTTCTCCCTCCATTCTTGCAAATGTCATCATATACCTC[G/A]
TTTATAACTCGAGAAACCATGAACTGCTTCTTGTTCTCATAATCAATTAAGGGTGACCTTTTGAATTTCGCTGGTTTCACCACCCTTTTATTGTACTCAT

Reverse complement sequence

ATGAGTACAATAAAAGGGTGGTGAAACCAGCGAAATTCAAAAGGTCACCCTTAATTGATTATGAGAACAAGAAGCAGTTCATGGTTTCTCGAGTTATAAA[C/T]
GAGGTATATGATGACATTTGCAAGAATGGAGGGAGAACCAAGTCAAGAAGGAATAGGTACAATCACATATTTTTTGCTGTACACAGTACTTTTTTACTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.40% 0.30% 3.96% 14.39% NA
All Indica  2759 77.90% 0.40% 4.82% 16.89% NA
All Japonica  1512 98.70% 0.00% 0.26% 0.99% NA
Aus  269 19.00% 0.00% 13.38% 67.66% NA
Indica I  595 70.60% 1.00% 8.07% 20.34% NA
Indica II  465 91.60% 0.20% 1.08% 7.10% NA
Indica III  913 76.00% 0.00% 4.93% 19.06% NA
Indica Intermediate  786 77.40% 0.60% 4.45% 17.56% NA
Temperate Japonica  767 99.10% 0.00% 0.00% 0.91% NA
Tropical Japonica  504 98.00% 0.00% 0.60% 1.39% NA
Japonica Intermediate  241 99.20% 0.00% 0.41% 0.41% NA
VI/Aromatic  96 87.50% 0.00% 8.33% 4.17% NA
Intermediate  90 78.90% 0.00% 6.67% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0209216559 G -> A LOC_Os02g16220.1 synonymous_variant ; p.Asn812Asn; LOW synonymous_codon Average:16.786; most accessible tissue: Callus, score: 26.283 N N N N
vg0209216559 G -> DEL LOC_Os02g16220.1 N frameshift_variant Average:16.786; most accessible tissue: Callus, score: 26.283 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0209216559 NA 2.33E-07 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209216559 NA 1.06E-07 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209216559 NA 6.20E-06 mr1219 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209216559 NA 2.65E-07 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209216559 NA 4.06E-07 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209216559 NA 2.30E-10 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209216559 NA 2.05E-10 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209216559 NA 6.07E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209216559 NA 3.55E-08 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209216559 5.33E-06 1.56E-10 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209216559 NA 2.85E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209216559 NA 8.64E-12 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209216559 NA 1.86E-11 mr1274_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209216559 NA 4.06E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209216559 NA 1.14E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209216559 NA 6.51E-06 mr1901_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209216559 NA 1.57E-06 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209216559 NA 6.61E-06 mr1930_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251