\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0209213036:

Variant ID: vg0209213036 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 9213036
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACATCATAAGTTACTTGTTGCATTCATTGAGTTACATCAAGTCCTGATAAAAGTTACTTCCAGTAGAATGTGAAGTTACATTTTTTTAAAAAAAAAAGGT[A/G]
AAAAAGTAACTAAGTTTACAAGTTACATTTTTAGTGTTTGTTCTATAGTTCAAAATTGTACTGATTTACTTCCAGCAAACACAAACTGTACAAACTACGC

Reverse complement sequence

GCGTAGTTTGTACAGTTTGTGTTTGCTGGAAGTAAATCAGTACAATTTTGAACTATAGAACAAACACTAAAAATGTAACTTGTAAACTTAGTTACTTTTT[T/C]
ACCTTTTTTTTTTAAAAAAATGTAACTTCACATTCTACTGGAAGTAACTTTTATCAGGACTTGATGTAACTCAATGAATGCAACAAGTAACTTATGATGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.10% 0.40% 5.63% 9.94% NA
All Indica  2759 81.50% 0.60% 7.76% 10.18% NA
All Japonica  1512 98.90% 0.10% 0.13% 0.86% NA
Aus  269 24.90% 0.00% 15.61% 59.48% NA
Indica I  595 72.60% 0.20% 14.12% 13.11% NA
Indica II  465 92.30% 1.30% 1.72% 4.73% NA
Indica III  913 81.50% 0.30% 7.89% 10.30% NA
Indica Intermediate  786 81.80% 0.80% 6.36% 11.07% NA
Temperate Japonica  767 99.00% 0.10% 0.00% 0.91% NA
Tropical Japonica  504 98.60% 0.00% 0.40% 0.99% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 91.70% 0.00% 4.17% 4.17% NA
Intermediate  90 82.20% 0.00% 4.44% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0209213036 A -> G LOC_Os02g16200.1 upstream_gene_variant ; 2705.0bp to feature; MODIFIER silent_mutation Average:13.235; most accessible tissue: Minghui63 flower, score: 19.775 N N N N
vg0209213036 A -> G LOC_Os02g16220.1 downstream_gene_variant ; 2231.0bp to feature; MODIFIER silent_mutation Average:13.235; most accessible tissue: Minghui63 flower, score: 19.775 N N N N
vg0209213036 A -> G LOC_Os02g16210.1 intron_variant ; MODIFIER silent_mutation Average:13.235; most accessible tissue: Minghui63 flower, score: 19.775 N N N N
vg0209213036 A -> DEL N N silent_mutation Average:13.235; most accessible tissue: Minghui63 flower, score: 19.775 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0209213036 NA 6.48E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036 NA 4.59E-07 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036 9.08E-06 NA mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036 NA 5.52E-06 mr1199_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036 NA 1.22E-07 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036 NA 8.75E-08 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036 NA 1.90E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036 NA 1.45E-07 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036 NA 2.68E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036 NA 3.35E-06 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036 NA 4.90E-06 mr1567_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036 7.76E-06 NA mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036 NA 7.73E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036 NA 7.13E-08 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036 NA 5.72E-06 mr1901_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036 NA 7.38E-06 mr1909_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036 2.27E-06 3.18E-06 mr1930_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036 2.40E-06 2.68E-07 mr1930_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251