Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0209213036:

Variant ID: vg0209213036 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 9213036
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACATCATAAGTTACTTGTTGCATTCATTGAGTTACATCAAGTCCTGATAAAAGTTACTTCCAGTAGAATGTGAAGTTACATTTTTTTAAAAAAAAAAGGT[A/G]
AAAAAGTAACTAAGTTTACAAGTTACATTTTTAGTGTTTGTTCTATAGTTCAAAATTGTACTGATTTACTTCCAGCAAACACAAACTGTACAAACTACGC

Reverse complement sequence

GCGTAGTTTGTACAGTTTGTGTTTGCTGGAAGTAAATCAGTACAATTTTGAACTATAGAACAAACACTAAAAATGTAACTTGTAAACTTAGTTACTTTTT[T/C]
ACCTTTTTTTTTTAAAAAAATGTAACTTCACATTCTACTGGAAGTAACTTTTATCAGGACTTGATGTAACTCAATGAATGCAACAAGTAACTTATGATGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.10%	0.40%	5.63%	9.94%	NA
All Indica	2759	81.50%	0.60%	7.76%	10.18%	NA
All Japonica	1512	98.90%	0.10%	0.13%	0.86%	NA
Aus	269	24.90%	0.00%	15.61%	59.48%	NA
Indica I	595	72.60%	0.20%	14.12%	13.11%	NA
Indica II	465	92.30%	1.30%	1.72%	4.73%	NA
Indica III	913	81.50%	0.30%	7.89%	10.30%	NA
Indica Intermediate	786	81.80%	0.80%	6.36%	11.07%	NA
Temperate Japonica	767	99.00%	0.10%	0.00%	0.91%	NA
Tropical Japonica	504	98.60%	0.00%	0.40%	0.99%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	91.70%	0.00%	4.17%	4.17%	NA
Intermediate	90	82.20%	0.00%	4.44%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0209213036	A -> G	LOC_Os02g16200.1	upstream_gene_variant ; 2705.0bp to feature; MODIFIER	silent_mutation	Average:13.235; most accessible tissue: Minghui63 flower, score: 19.775	N	N	N	N
vg0209213036	A -> G	LOC_Os02g16220.1	downstream_gene_variant ; 2231.0bp to feature; MODIFIER	silent_mutation	Average:13.235; most accessible tissue: Minghui63 flower, score: 19.775	N	N	N	N
vg0209213036	A -> G	LOC_Os02g16210.1	intron_variant ; MODIFIER	silent_mutation	Average:13.235; most accessible tissue: Minghui63 flower, score: 19.775	N	N	N	N
vg0209213036	A -> DEL	N	N	silent_mutation	Average:13.235; most accessible tissue: Minghui63 flower, score: 19.775	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0209213036	NA	6.48E-07	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036	NA	4.59E-07	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036	9.08E-06	NA	mr1145_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036	NA	5.52E-06	mr1199_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036	NA	1.22E-07	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036	NA	8.75E-08	mr1201_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036	NA	1.90E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036	NA	1.45E-07	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036	NA	2.68E-06	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036	NA	3.35E-06	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036	NA	4.90E-06	mr1567_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036	7.76E-06	NA	mr1731_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036	NA	7.73E-07	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036	NA	7.13E-08	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036	NA	5.72E-06	mr1901_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036	NA	7.38E-06	mr1909_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036	2.27E-06	3.18E-06	mr1930_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213036	2.40E-06	2.68E-07	mr1930_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251