\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0209208522:

Variant ID: vg0209208522 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 9208522
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.22, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


TCCTCCGTGCTACCAATGCCGGAGGTTTCCCCCTCCTGAGGAACCACGGGCGCGGGCTCGGCACGAGGGGTCTCCACGAAGCAGGTCCACGCCAGGGACT[A/G]
ACGAACAAGCTCAGGCCTGGAGGTGCTCTTGCGGGCAGTGATCTTCTGGCTGCGGCAGACGCGGCGGCGCTTGGGACGGCAGACCTCTCCCTGGGCGACC

Reverse complement sequence

GGTCGCCCAGGGAGAGGTCTGCCGTCCCAAGCGCCGCCGCGTCTGCCGCAGCCAGAAGATCACTGCCCGCAAGAGCACCTCCAGGCCTGAGCTTGTTCGT[T/C]
AGTCCCTGGCGTGGACCTGCTTCGTGGAGACCCCTCGTGCCGAGCCCGCGCCCGTGGTTCCTCAGGAGGGGGAAACCTCCGGCATTGGTAGCACGGAGGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.80% 7.00% 25.35% 9.88% NA
All Indica  2759 31.40% 11.70% 41.25% 15.66% NA
All Japonica  1512 98.30% 0.10% 1.19% 0.46% NA
Aus  269 82.50% 0.70% 8.55% 8.18% NA
Indica I  595 61.70% 4.20% 23.36% 10.76% NA
Indica II  465 23.70% 7.10% 44.73% 24.52% NA
Indica III  913 14.10% 20.80% 49.29% 15.77% NA
Indica Intermediate  786 33.20% 9.40% 43.38% 13.99% NA
Temperate Japonica  767 98.40% 0.10% 0.78% 0.65% NA
Tropical Japonica  504 97.80% 0.00% 1.98% 0.20% NA
Japonica Intermediate  241 98.80% 0.00% 0.83% 0.41% NA
VI/Aromatic  96 96.90% 0.00% 3.12% 0.00% NA
Intermediate  90 70.00% 5.60% 17.78% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0209208522 A -> G LOC_Os02g16210.1 upstream_gene_variant ; 2167.0bp to feature; MODIFIER silent_mutation Average:54.991; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 N N N N
vg0209208522 A -> G LOC_Os02g16190.1 downstream_gene_variant ; 4241.0bp to feature; MODIFIER silent_mutation Average:54.991; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 N N N N
vg0209208522 A -> G LOC_Os02g16200.1 intron_variant ; MODIFIER silent_mutation Average:54.991; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 N N N N
vg0209208522 A -> DEL N N silent_mutation Average:54.991; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0209208522 A G 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0209208522 6.63E-06 NA mr1004 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209208522 4.53E-06 NA mr1005 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209208522 5.91E-06 NA mr1010 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209208522 3.39E-07 9.96E-06 mr1011 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209208522 2.27E-07 4.62E-06 mr1012 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209208522 5.09E-07 NA mr1163 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209208522 NA 1.08E-07 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209208522 NA 5.12E-11 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251