\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0209194358:

Variant ID: vg0209194358 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 9194358
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGGTACTTGTTTTCGATAGTGACTTCATTGAGAGCTCTGTAGTCAACACACATCCTCTTCGTCTTATCCTTCTTCTCCACAAAAATCACGGGAGCACCC[T/C]
AGGGGGAAGTGCTCGGCCGTATATACCCCTTTTCCTTCAGCTCTTCCAATTGCTTCTTGACTTCGGCAAGTTCATTTGCTGCCATACGGTAGGGCCGTTT

Reverse complement sequence

AAACGGCCCTACCGTATGGCAGCAAATGAACTTGCCGAAGTCAAGAAGCAATTGGAAGAGCTGAAGGAAAAGGGGTATATACGGCCGAGCACTTCCCCCT[A/G]
GGGTGCTCCCGTGATTTTTGTGGAGAAGAAGGATAAGACGAAGAGGATGTGTGTTGACTACAGAGCTCTCAATGAAGTCACTATCGAAAACAAGTACCCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.20% 1.00% 4.46% 7.34% NA
All Indica  2759 82.00% 1.10% 5.62% 11.24% NA
All Japonica  1512 99.60% 0.00% 0.00% 0.40% NA
Aus  269 63.60% 5.60% 20.45% 10.41% NA
Indica I  595 82.40% 1.20% 8.57% 7.90% NA
Indica II  465 83.70% 0.40% 3.87% 12.04% NA
Indica III  913 80.70% 0.90% 5.37% 13.03% NA
Indica Intermediate  786 82.30% 1.80% 4.71% 11.20% NA
Temperate Japonica  767 99.30% 0.00% 0.00% 0.65% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 96.70% 0.00% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0209194358 T -> DEL N N silent_mutation Average:26.215; most accessible tissue: Minghui63 flag leaf, score: 63.692 N N N N
vg0209194358 T -> C LOC_Os02g16180.1 upstream_gene_variant ; 4450.0bp to feature; MODIFIER silent_mutation Average:26.215; most accessible tissue: Minghui63 flag leaf, score: 63.692 N N N N
vg0209194358 T -> C LOC_Os02g16160.1 downstream_gene_variant ; 2079.0bp to feature; MODIFIER silent_mutation Average:26.215; most accessible tissue: Minghui63 flag leaf, score: 63.692 N N N N
vg0209194358 T -> C LOC_Os02g16160-LOC_Os02g16180 intergenic_region ; MODIFIER silent_mutation Average:26.215; most accessible tissue: Minghui63 flag leaf, score: 63.692 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0209194358 NA 1.68E-15 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209194358 NA 3.08E-26 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209194358 NA 8.87E-11 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209194358 NA 2.11E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209194358 NA 1.92E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209194358 NA 1.32E-26 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209194358 NA 3.32E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209194358 NA 1.89E-22 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209194358 NA 1.12E-12 mr1595_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209194358 NA 8.14E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251