\
| Variant ID: vg0209194358 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 9194358 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AGGGTACTTGTTTTCGATAGTGACTTCATTGAGAGCTCTGTAGTCAACACACATCCTCTTCGTCTTATCCTTCTTCTCCACAAAAATCACGGGAGCACCC[T/C]
AGGGGGAAGTGCTCGGCCGTATATACCCCTTTTCCTTCAGCTCTTCCAATTGCTTCTTGACTTCGGCAAGTTCATTTGCTGCCATACGGTAGGGCCGTTT
AAACGGCCCTACCGTATGGCAGCAAATGAACTTGCCGAAGTCAAGAAGCAATTGGAAGAGCTGAAGGAAAAGGGGTATATACGGCCGAGCACTTCCCCCT[A/G]
GGGTGCTCCCGTGATTTTTGTGGAGAAGAAGGATAAGACGAAGAGGATGTGTGTTGACTACAGAGCTCTCAATGAAGTCACTATCGAAAACAAGTACCCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.20% | 1.00% | 4.46% | 7.34% | NA |
| All Indica | 2759 | 82.00% | 1.10% | 5.62% | 11.24% | NA |
| All Japonica | 1512 | 99.60% | 0.00% | 0.00% | 0.40% | NA |
| Aus | 269 | 63.60% | 5.60% | 20.45% | 10.41% | NA |
| Indica I | 595 | 82.40% | 1.20% | 8.57% | 7.90% | NA |
| Indica II | 465 | 83.70% | 0.40% | 3.87% | 12.04% | NA |
| Indica III | 913 | 80.70% | 0.90% | 5.37% | 13.03% | NA |
| Indica Intermediate | 786 | 82.30% | 1.80% | 4.71% | 11.20% | NA |
| Temperate Japonica | 767 | 99.30% | 0.00% | 0.00% | 0.65% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 0.00% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0209194358 | T -> DEL | N | N | silent_mutation | Average:26.215; most accessible tissue: Minghui63 flag leaf, score: 63.692 | N | N | N | N |
| vg0209194358 | T -> C | LOC_Os02g16180.1 | upstream_gene_variant ; 4450.0bp to feature; MODIFIER | silent_mutation | Average:26.215; most accessible tissue: Minghui63 flag leaf, score: 63.692 | N | N | N | N |
| vg0209194358 | T -> C | LOC_Os02g16160.1 | downstream_gene_variant ; 2079.0bp to feature; MODIFIER | silent_mutation | Average:26.215; most accessible tissue: Minghui63 flag leaf, score: 63.692 | N | N | N | N |
| vg0209194358 | T -> C | LOC_Os02g16160-LOC_Os02g16180 | intergenic_region ; MODIFIER | silent_mutation | Average:26.215; most accessible tissue: Minghui63 flag leaf, score: 63.692 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0209194358 | NA | 1.68E-15 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209194358 | NA | 3.08E-26 | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209194358 | NA | 8.87E-11 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209194358 | NA | 2.11E-06 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209194358 | NA | 1.92E-07 | mr1149_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209194358 | NA | 1.32E-26 | mr1441_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209194358 | NA | 3.32E-08 | mr1441_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209194358 | NA | 1.89E-22 | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209194358 | NA | 1.12E-12 | mr1595_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209194358 | NA | 8.14E-06 | mr1611_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |