Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0209194358:

Variant ID: vg0209194358 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 9194358
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGGGTACTTGTTTTCGATAGTGACTTCATTGAGAGCTCTGTAGTCAACACACATCCTCTTCGTCTTATCCTTCTTCTCCACAAAAATCACGGGAGCACCC[T/C]
AGGGGGAAGTGCTCGGCCGTATATACCCCTTTTCCTTCAGCTCTTCCAATTGCTTCTTGACTTCGGCAAGTTCATTTGCTGCCATACGGTAGGGCCGTTT

Reverse complement sequence

AAACGGCCCTACCGTATGGCAGCAAATGAACTTGCCGAAGTCAAGAAGCAATTGGAAGAGCTGAAGGAAAAGGGGTATATACGGCCGAGCACTTCCCCCT[A/G]
GGGTGCTCCCGTGATTTTTGTGGAGAAGAAGGATAAGACGAAGAGGATGTGTGTTGACTACAGAGCTCTCAATGAAGTCACTATCGAAAACAAGTACCCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.20%	1.00%	4.46%	7.34%	NA
All Indica	2759	82.00%	1.10%	5.62%	11.24%	NA
All Japonica	1512	99.60%	0.00%	0.00%	0.40%	NA
Aus	269	63.60%	5.60%	20.45%	10.41%	NA
Indica I	595	82.40%	1.20%	8.57%	7.90%	NA
Indica II	465	83.70%	0.40%	3.87%	12.04%	NA
Indica III	913	80.70%	0.90%	5.37%	13.03%	NA
Indica Intermediate	786	82.30%	1.80%	4.71%	11.20%	NA
Temperate Japonica	767	99.30%	0.00%	0.00%	0.65%	NA
Tropical Japonica	504	99.80%	0.00%	0.00%	0.20%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	96.70%	0.00%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0209194358	T -> DEL	N	N	silent_mutation	Average:26.215; most accessible tissue: Minghui63 flag leaf, score: 63.692	N	N	N	N
vg0209194358	T -> C	LOC_Os02g16180.1	upstream_gene_variant ; 4450.0bp to feature; MODIFIER	silent_mutation	Average:26.215; most accessible tissue: Minghui63 flag leaf, score: 63.692	N	N	N	N
vg0209194358	T -> C	LOC_Os02g16160.1	downstream_gene_variant ; 2079.0bp to feature; MODIFIER	silent_mutation	Average:26.215; most accessible tissue: Minghui63 flag leaf, score: 63.692	N	N	N	N
vg0209194358	T -> C	LOC_Os02g16160-LOC_Os02g16180	intergenic_region ; MODIFIER	silent_mutation	Average:26.215; most accessible tissue: Minghui63 flag leaf, score: 63.692	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0209194358	NA	1.68E-15	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209194358	NA	3.08E-26	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209194358	NA	8.87E-11	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209194358	NA	2.11E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209194358	NA	1.92E-07	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209194358	NA	1.32E-26	mr1441_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209194358	NA	3.32E-08	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209194358	NA	1.89E-22	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209194358	NA	1.12E-12	mr1595_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209194358	NA	8.14E-06	mr1611_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251