\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0209189237:

Variant ID: vg0209189237 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 9189237
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.18, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


AGTGTCTAATACGAATTATTACATCATAGGCCCGCAGGCATAGTCTTAAATCATCGGACCGAGCGGTCCGGAATACATCCAAAAACAGAAATAGATAAGG[T/C]
AGCGGAATTCAGGCAGCGGCATGCCATTGCCACAGGCAACGACCGTACTAAGACCTACTGGGCACCATCGTCTTCGTCTCCCTCCTGGTAGTAGGCATAG

Reverse complement sequence

CTATGCCTACTACCAGGAGGGAGACGAAGACGATGGTGCCCAGTAGGTCTTAGTACGGTCGTTGCCTGTGGCAATGGCATGCCGCTGCCTGAATTCCGCT[A/G]
CCTTATCTATTTCTGTTTTTGGATGTATTCCGGACCGCTCGGTCCGATGATTTAAGACTATGCCTGCGGGCCTATGATGTAATAATTCGTATTAGACACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.70% 6.40% 28.80% 18.15% NA
All Indica  2759 20.20% 3.80% 45.92% 30.08% NA
All Japonica  1512 98.20% 0.20% 0.99% 0.60% NA
Aus  269 9.30% 68.40% 20.07% 2.23% NA
Indica I  595 45.50% 0.70% 35.97% 17.82% NA
Indica II  465 20.20% 6.50% 41.94% 31.40% NA
Indica III  913 2.30% 3.60% 55.64% 38.44% NA
Indica Intermediate  786 21.80% 4.80% 44.53% 28.88% NA
Temperate Japonica  767 98.30% 0.30% 0.52% 0.91% NA
Tropical Japonica  504 98.00% 0.00% 1.79% 0.20% NA
Japonica Intermediate  241 98.30% 0.40% 0.83% 0.41% NA
VI/Aromatic  96 86.50% 6.20% 7.29% 0.00% NA
Intermediate  90 61.10% 4.40% 20.00% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0209189237 T -> DEL N N silent_mutation Average:11.524; most accessible tissue: Minghui63 root, score: 17.665 N N N N
vg0209189237 T -> C LOC_Os02g16150.1 upstream_gene_variant ; 467.0bp to feature; MODIFIER silent_mutation Average:11.524; most accessible tissue: Minghui63 root, score: 17.665 N N N N
vg0209189237 T -> C LOC_Os02g16160.1 upstream_gene_variant ; 2608.0bp to feature; MODIFIER silent_mutation Average:11.524; most accessible tissue: Minghui63 root, score: 17.665 N N N N
vg0209189237 T -> C LOC_Os02g16140.1 downstream_gene_variant ; 3530.0bp to feature; MODIFIER silent_mutation Average:11.524; most accessible tissue: Minghui63 root, score: 17.665 N N N N
vg0209189237 T -> C LOC_Os02g16150-LOC_Os02g16160 intergenic_region ; MODIFIER silent_mutation Average:11.524; most accessible tissue: Minghui63 root, score: 17.665 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0209189237 NA 5.57E-13 mr1471 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209189237 NA 6.67E-12 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209189237 NA 7.80E-08 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251