Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0209160076:

Variant ID: vg0209160076 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 9160076
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:

GTAATGGTTTTCTCATGAAGGAAGGTGATGATAGTAGGCCATATTATGTAATGCATGACTTATTACATGATCTAGCACAAAATATTTCGTCACAAGAGTG[C/T]
ATCAACATAAGTTCATATAGTTTTAGGTCTAATAGCATCCCGCAATCTATTAGACATGTATCCATCACCTTACAAGATAAGTATGAGGAAAGTTTTGAGA

Reverse complement sequence

TCTCAAAACTTTCCTCATACTTATCTTGTAAGGTGATGGATACATGTCTAATAGATTGCGGGATGCTATTAGACCTAAAACTATATGAACTTATGTTGAT[G/A]
CACTCTTGTGACGAAATATTTTGTGCTAGATCATGTAATAAGTCATGCATTACATAATATGGCCTACTATCATCACCTTCCTTCATGAGAAAACCATTAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.10%	6.50%	1.08%	45.32%	NA
All Indica	2759	20.90%	3.00%	1.70%	74.30%	NA
All Japonica	1512	98.10%	0.10%	0.13%	1.59%	NA
Aus	269	8.90%	75.10%	0.00%	15.99%	NA
Indica I	595	47.10%	0.20%	1.34%	51.43%	NA
Indica II	465	19.80%	1.10%	1.94%	77.20%	NA
Indica III	913	3.10%	3.80%	1.75%	91.35%	NA
Indica Intermediate	786	22.60%	5.50%	1.78%	70.10%	NA
Temperate Japonica	767	98.30%	0.10%	0.13%	1.43%	NA
Tropical Japonica	504	97.80%	0.00%	0.20%	1.98%	NA
Japonica Intermediate	241	98.30%	0.40%	0.00%	1.24%	NA
VI/Aromatic	96	86.50%	12.50%	0.00%	1.04%	NA
Intermediate	90	64.40%	6.70%	2.22%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0209160076	C -> T	LOC_Os02g16100.1	upstream_gene_variant ; 487.0bp to feature; MODIFIER	silent_mutation	Average:10.754; most accessible tissue: Callus, score: 43.355	N	N	N	N
vg0209160076	C -> T	LOC_Os02g16110.1	upstream_gene_variant ; 3189.0bp to feature; MODIFIER	silent_mutation	Average:10.754; most accessible tissue: Callus, score: 43.355	N	N	N	N
vg0209160076	C -> T	LOC_Os02g16090.1	downstream_gene_variant ; 1310.0bp to feature; MODIFIER	silent_mutation	Average:10.754; most accessible tissue: Callus, score: 43.355	N	N	N	N
vg0209160076	C -> T	LOC_Os02g16090-LOC_Os02g16100	intergenic_region ; MODIFIER	silent_mutation	Average:10.754; most accessible tissue: Callus, score: 43.355	N	N	N	N
vg0209160076	C -> DEL	N	N	silent_mutation	Average:10.754; most accessible tissue: Callus, score: 43.355	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0209160076	NA	5.30E-10	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209160076	NA	1.42E-08	mr1222	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209160076	NA	1.51E-11	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209160076	3.84E-06	3.84E-06	mr1883	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209160076	NA	7.83E-14	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209160076	NA	1.09E-10	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251