\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0209141112:

Variant ID: vg0209141112 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 9141112
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATTTATACCATGCTAGACATCTAATCTCCTTCTTCCAACTCCTTATGTTTCAGATTATAAGTCATTTTAAATTTTGTCAATGTCAAATTACTTGAATT[A/T]
GTTTATAAAAAACATAGTAATATTTTCTACACAAAACAATCATATTATAAAACATATTCAATTTTGAATTCAATAAAAATAATTTGGTGTTGTAAATATT

Reverse complement sequence

AATATTTACAACACCAAATTATTTTTATTGAATTCAAAATTGAATATGTTTTATAATATGATTGTTTTGTGTAGAAAATATTACTATGTTTTTTATAAAC[T/A]
AATTCAAGTAATTTGACATTGACAAAATTTAAAATGACTTATAATCTGAAACATAAGGAGTTGGAAGAAGGAGATTAGATGTCTAGCATGGTATAAATAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.50% 1.60% 2.62% 26.32% NA
All Indica  2759 53.90% 0.00% 2.61% 43.49% NA
All Japonica  1512 92.50% 4.90% 1.39% 1.26% NA
Aus  269 84.80% 0.00% 10.78% 4.46% NA
Indica I  595 53.60% 0.00% 1.18% 45.21% NA
Indica II  465 61.50% 0.00% 3.01% 35.48% NA
Indica III  913 47.40% 0.00% 1.20% 51.37% NA
Indica Intermediate  786 57.10% 0.00% 5.09% 37.79% NA
Temperate Japonica  767 88.90% 8.00% 2.48% 0.65% NA
Tropical Japonica  504 97.60% 0.00% 0.00% 2.38% NA
Japonica Intermediate  241 92.90% 5.40% 0.83% 0.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 83.30% 0.00% 2.22% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0209141112 A -> T LOC_Os02g16070.1 upstream_gene_variant ; 1346.0bp to feature; MODIFIER silent_mutation Average:13.792; most accessible tissue: Minghui63 flag leaf, score: 21.636 N N N N
vg0209141112 A -> T LOC_Os02g16060.1 downstream_gene_variant ; 979.0bp to feature; MODIFIER silent_mutation Average:13.792; most accessible tissue: Minghui63 flag leaf, score: 21.636 N N N N
vg0209141112 A -> T LOC_Os02g16060-LOC_Os02g16070 intergenic_region ; MODIFIER silent_mutation Average:13.792; most accessible tissue: Minghui63 flag leaf, score: 21.636 N N N N
vg0209141112 A -> DEL N N silent_mutation Average:13.792; most accessible tissue: Minghui63 flag leaf, score: 21.636 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0209141112 5.71E-07 5.71E-07 mr1122 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209141112 4.14E-06 4.14E-06 mr1412 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209141112 1.62E-06 1.62E-06 mr1802 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209141112 NA 3.75E-07 mr1896 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209141112 3.61E-06 3.61E-06 mr1935 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251