\
| Variant ID: vg0209141112 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 9141112 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTATTTATACCATGCTAGACATCTAATCTCCTTCTTCCAACTCCTTATGTTTCAGATTATAAGTCATTTTAAATTTTGTCAATGTCAAATTACTTGAATT[A/T]
GTTTATAAAAAACATAGTAATATTTTCTACACAAAACAATCATATTATAAAACATATTCAATTTTGAATTCAATAAAAATAATTTGGTGTTGTAAATATT
AATATTTACAACACCAAATTATTTTTATTGAATTCAAAATTGAATATGTTTTATAATATGATTGTTTTGTGTAGAAAATATTACTATGTTTTTTATAAAC[T/A]
AATTCAAGTAATTTGACATTGACAAAATTTAAAATGACTTATAATCTGAAACATAAGGAGTTGGAAGAAGGAGATTAGATGTCTAGCATGGTATAAATAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.50% | 1.60% | 2.62% | 26.32% | NA |
| All Indica | 2759 | 53.90% | 0.00% | 2.61% | 43.49% | NA |
| All Japonica | 1512 | 92.50% | 4.90% | 1.39% | 1.26% | NA |
| Aus | 269 | 84.80% | 0.00% | 10.78% | 4.46% | NA |
| Indica I | 595 | 53.60% | 0.00% | 1.18% | 45.21% | NA |
| Indica II | 465 | 61.50% | 0.00% | 3.01% | 35.48% | NA |
| Indica III | 913 | 47.40% | 0.00% | 1.20% | 51.37% | NA |
| Indica Intermediate | 786 | 57.10% | 0.00% | 5.09% | 37.79% | NA |
| Temperate Japonica | 767 | 88.90% | 8.00% | 2.48% | 0.65% | NA |
| Tropical Japonica | 504 | 97.60% | 0.00% | 0.00% | 2.38% | NA |
| Japonica Intermediate | 241 | 92.90% | 5.40% | 0.83% | 0.83% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 0.00% | 2.22% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0209141112 | A -> T | LOC_Os02g16070.1 | upstream_gene_variant ; 1346.0bp to feature; MODIFIER | silent_mutation | Average:13.792; most accessible tissue: Minghui63 flag leaf, score: 21.636 | N | N | N | N |
| vg0209141112 | A -> T | LOC_Os02g16060.1 | downstream_gene_variant ; 979.0bp to feature; MODIFIER | silent_mutation | Average:13.792; most accessible tissue: Minghui63 flag leaf, score: 21.636 | N | N | N | N |
| vg0209141112 | A -> T | LOC_Os02g16060-LOC_Os02g16070 | intergenic_region ; MODIFIER | silent_mutation | Average:13.792; most accessible tissue: Minghui63 flag leaf, score: 21.636 | N | N | N | N |
| vg0209141112 | A -> DEL | N | N | silent_mutation | Average:13.792; most accessible tissue: Minghui63 flag leaf, score: 21.636 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0209141112 | 5.71E-07 | 5.71E-07 | mr1122 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209141112 | 4.14E-06 | 4.14E-06 | mr1412 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209141112 | 1.62E-06 | 1.62E-06 | mr1802 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209141112 | NA | 3.75E-07 | mr1896 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209141112 | 3.61E-06 | 3.61E-06 | mr1935 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |