Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0209088883:

Variant ID: vg0209088883 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 9088883
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACTGAATAGTGTTTTTGAATAGTAATCAGCCGAATAAACAGTAAACTGAATAGTATTCAGCCGAATAAATAGTGTTTTTGAACAGTGTATATTGTCTGA[A/G]
GTATAAGTGTGGTATCAGAGCCAGTCATCATAGAGAAATCAAATTCAAAAGCTAATATTGGAAAGATAATTACTACCAAAGATAATCTGAATATAAGGTG

Reverse complement sequence

CACCTTATATTCAGATTATCTTTGGTAGTAATTATCTTTCCAATATTAGCTTTTGAATTTGATTTCTCTATGATGACTGGCTCTGATACCACACTTATAC[T/C]
TCAGACAATATACACTGTTCAAAAACACTATTTATTCGGCTGAATACTATTCAGTTTACTGTTTATTCGGCTGATTACTATTCAAAAACACTATTCAGTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.00%	1.80%	22.51%	30.68%	NA
All Indica	2759	9.10%	3.00%	37.15%	50.74%	NA
All Japonica	1512	98.60%	0.00%	0.53%	0.86%	NA
Aus	269	87.40%	0.00%	7.06%	5.58%	NA
Indica I	595	2.50%	2.70%	41.85%	52.94%	NA
Indica II	465	4.70%	1.70%	23.66%	69.89%	NA
Indica III	913	11.60%	4.20%	39.98%	44.25%	NA
Indica Intermediate	786	13.70%	2.70%	38.30%	45.29%	NA
Temperate Japonica	767	99.30%	0.00%	0.13%	0.52%	NA
Tropical Japonica	504	97.40%	0.00%	1.19%	1.39%	NA
Japonica Intermediate	241	98.80%	0.00%	0.41%	0.83%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	60.00%	2.20%	13.33%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0209088883	A -> G	LOC_Os02g16010.1	upstream_gene_variant ; 461.0bp to feature; MODIFIER	silent_mutation	Average:10.581; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0209088883	A -> G	LOC_Os02g16000.1	downstream_gene_variant ; 870.0bp to feature; MODIFIER	silent_mutation	Average:10.581; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0209088883	A -> G	LOC_Os02g16000.2	downstream_gene_variant ; 870.0bp to feature; MODIFIER	silent_mutation	Average:10.581; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0209088883	A -> G	LOC_Os02g16000-LOC_Os02g16010	intergenic_region ; MODIFIER	silent_mutation	Average:10.581; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0209088883	A -> DEL	N	N	silent_mutation	Average:10.581; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0209088883	NA	9.35E-06	mr1186_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209088883	NA	2.20E-06	mr1371_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209088883	NA	6.17E-06	mr1508_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209088883	NA	8.01E-06	mr1616_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209088883	NA	5.21E-06	mr1616_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209088883	NA	6.01E-06	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209088883	6.41E-06	6.41E-06	mr1652_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209088883	NA	4.52E-07	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209088883	NA	2.40E-06	mr1663_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209088883	NA	1.66E-07	mr1669_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209088883	NA	4.33E-06	mr1669_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209088883	NA	2.50E-06	mr1683_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209088883	2.65E-06	2.66E-06	mr1697_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209088883	4.96E-06	4.96E-06	mr1697_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209088883	NA	8.90E-06	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209088883	NA	2.82E-06	mr1971_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251