\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0209035448:

Variant ID: vg0209035448 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 9035448
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCTGACAGTATCCGGAGACACCGTAGGGTACTAGCCGTGCTTATCCCTGAAGTGATATCCGACGGCGTGTCTTGACGTATGTAGGCTTCTATGTTGATT[G/A]
TGTTGGGTGTTGATCCTGTCGGGTGTTGATCCCGTTGGGTGTTGATTGTCTTGTCCCCCCCTCTCCTCCTAGGGGGCCCTATATTTATACCCATAGGTGT

Reverse complement sequence

ACACCTATGGGTATAAATATAGGGCCCCCTAGGAGGAGAGGGGGGGACAAGACAATCAACACCCAACGGGATCAACACCCGACAGGATCAACACCCAACA[C/T]
AATCAACATAGAAGCCTACATACGTCAAGACACGCCGTCGGATATCACTTCAGGGATAAGCACGGCTAGTACCCTACGGTGTCTCCGGATACTGTCAGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.10% 19.50% 1.38% 1.97% NA
All Indica  2759 99.00% 0.90% 0.07% 0.00% NA
All Japonica  1512 37.90% 52.60% 3.77% 5.75% NA
Aus  269 93.30% 5.20% 1.49% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 1.90% 0.25% 0.00% NA
Temperate Japonica  767 65.40% 28.40% 3.91% 2.22% NA
Tropical Japonica  504 4.60% 79.60% 3.77% 12.10% NA
Japonica Intermediate  241 19.90% 73.00% 3.32% 3.73% NA
VI/Aromatic  96 31.20% 67.70% 0.00% 1.04% NA
Intermediate  90 66.70% 25.60% 2.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0209035448 G -> A LOC_Os02g15930-LOC_Os02g15950 intergenic_region ; MODIFIER silent_mutation Average:12.497; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0209035448 G -> DEL N N silent_mutation Average:12.497; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0209035448 NA 1.70E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0209035448 NA 4.19E-11 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209035448 NA 9.66E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209035448 NA 1.12E-12 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209035448 NA 1.03E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209035448 NA 9.47E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209035448 NA 1.09E-07 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209035448 NA 5.93E-06 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209035448 NA 4.21E-10 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209035448 NA 2.21E-09 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209035448 NA 1.39E-09 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209035448 NA 3.59E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209035448 NA 9.79E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209035448 NA 2.37E-09 mr1263_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209035448 NA 5.14E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209035448 NA 3.53E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209035448 NA 4.12E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209035448 NA 3.53E-08 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209035448 NA 8.58E-06 mr1729_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209035448 NA 3.41E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251