Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208884016:

Variant ID: vg0208884016 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 8884016
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

TACATCCTAGCATTTGCCGGCAAAGCCAAGTAAGCGTGATCAGTGCTTACCCACAGGAACTTGAATAAAGAACCAAATTGCACTCCTATGACTACGCATG[G/A]
TACTTGAATAATTGAAACCAGAATTAAAGAACCAAATTGAAACACATCCATGGCAAGCAGAGAACTTGACTTATTTAAGCAGAACCAGAATCCAGAATAT

Reverse complement sequence

ATATTCTGGATTCTGGTTCTGCTTAAATAAGTCAAGTTCTCTGCTTGCCATGGATGTGTTTCAATTTGGTTCTTTAATTCTGGTTTCAATTATTCAAGTA[C/T]
CATGCGTAGTCATAGGAGTGCAATTTGGTTCTTTATTCAAGTTCCTGTGGGTAAGCACTGATCACGCTTACTTGGCTTTGCCGGCAAATGCTAGGATGTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.40%	43.60%	0.00%	0.00%	NA
All Indica	2759	38.10%	61.90%	0.00%	0.00%	NA
All Japonica	1512	97.90%	2.10%	0.00%	0.00%	NA
Aus	269	1.50%	98.50%	0.00%	0.00%	NA
Indica I	595	2.90%	97.10%	0.00%	0.00%	NA
Indica II	465	40.60%	59.40%	0.00%	0.00%	NA
Indica III	913	66.00%	34.00%	0.00%	0.00%	NA
Indica Intermediate	786	30.90%	69.10%	0.00%	0.00%	NA
Temperate Japonica	767	98.30%	1.70%	0.00%	0.00%	NA
Tropical Japonica	504	97.80%	2.20%	0.00%	0.00%	NA
Japonica Intermediate	241	96.70%	3.30%	0.00%	0.00%	NA
VI/Aromatic	96	69.80%	30.20%	0.00%	0.00%	NA
Intermediate	90	68.90%	31.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208884016	G -> A	LOC_Os02g15760.1	upstream_gene_variant ; 1356.0bp to feature; MODIFIER	silent_mutation	Average:19.331; most accessible tissue: Callus, score: 24.858	N	N	N	N
vg0208884016	G -> A	LOC_Os02g15760-LOC_Os02g15770	intergenic_region ; MODIFIER	silent_mutation	Average:19.331; most accessible tissue: Callus, score: 24.858	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208884016	NA	7.24E-09	mr1050	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	9.96E-31	mr1074	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	3.66E-06	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	6.81E-06	mr1098	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	1.38E-26	mr1130	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	4.95E-06	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	4.39E-06	mr1148	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	1.25E-24	mr1150	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	2.31E-06	mr1150	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	1.64E-21	mr1168	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	3.92E-07	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	6.90E-21	mr1254	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	6.65E-12	mr1272	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	1.85E-09	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	2.45E-08	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	2.67E-23	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	2.52E-06	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	1.59E-07	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	8.77E-12	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	2.86E-07	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	7.50E-06	mr1929	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	8.54E-06	mr1036_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	2.90E-08	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	1.30E-15	mr1162_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	1.15E-08	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	1.04E-06	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	7.30E-06	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	9.47E-06	mr1349_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	1.84E-06	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	5.93E-12	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	3.24E-06	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	4.86E-18	mr1842_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	2.76E-07	mr1842_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	3.25E-12	mr1893_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	1.74E-06	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	5.68E-15	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	3.64E-06	mr1923_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	3.67E-25	mr1933_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208884016	NA	3.78E-11	mr1933_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251