\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208883943:

Variant ID: vg0208883943 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8883943
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.66, A: 0.33, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


CAAAGAAGATAGTAGTTCCCATCCCGGGCAGGTATGAATTGAAATAGTAGTTTCCATCCCGGACAATAGTGAATACATCCTAGCATTTGCCGGCAAAGCC[A/G]
AGTAAGCGTGATCAGTGCTTACCCACAGGAACTTGAATAAAGAACCAAATTGCACTCCTATGACTACGCATGGTACTTGAATAATTGAAACCAGAATTAA

Reverse complement sequence

TTAATTCTGGTTTCAATTATTCAAGTACCATGCGTAGTCATAGGAGTGCAATTTGGTTCTTTATTCAAGTTCCTGTGGGTAAGCACTGATCACGCTTACT[T/C]
GGCTTTGCCGGCAAATGCTAGGATGTATTCACTATTGTCCGGGATGGAAACTACTATTTCAATTCATACCTGCCCGGGATGGGAACTACTATCTTCTTTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.20% 43.70% 0.19% 0.00% NA
All Indica  2759 37.80% 62.00% 0.25% 0.00% NA
All Japonica  1512 97.90% 2.10% 0.00% 0.00% NA
Aus  269 2.60% 97.40% 0.00% 0.00% NA
Indica I  595 4.70% 94.60% 0.67% 0.00% NA
Indica II  465 40.60% 59.10% 0.22% 0.00% NA
Indica III  913 63.50% 36.50% 0.00% 0.00% NA
Indica Intermediate  786 31.20% 68.60% 0.25% 0.00% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 2.20% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 69.80% 30.20% 0.00% 0.00% NA
Intermediate  90 64.40% 33.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208883943 A -> G LOC_Os02g15760.1 upstream_gene_variant ; 1283.0bp to feature; MODIFIER silent_mutation Average:21.223; most accessible tissue: Minghui63 young leaf, score: 28.65 N N N N
vg0208883943 A -> G LOC_Os02g15760-LOC_Os02g15770 intergenic_region ; MODIFIER silent_mutation Average:21.223; most accessible tissue: Minghui63 young leaf, score: 28.65 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208883943 NA 1.07E-08 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208883943 NA 4.10E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208883943 NA 3.54E-07 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208883943 NA 6.11E-12 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208883943 NA 1.46E-09 mr1278 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208883943 NA 2.40E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208883943 NA 5.08E-07 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208883943 NA 1.18E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208883943 NA 3.76E-11 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251