\
| Variant ID: vg0208883943 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8883943 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.66, A: 0.33, others allele: 0.00, population size: 209. )
CAAAGAAGATAGTAGTTCCCATCCCGGGCAGGTATGAATTGAAATAGTAGTTTCCATCCCGGACAATAGTGAATACATCCTAGCATTTGCCGGCAAAGCC[A/G]
AGTAAGCGTGATCAGTGCTTACCCACAGGAACTTGAATAAAGAACCAAATTGCACTCCTATGACTACGCATGGTACTTGAATAATTGAAACCAGAATTAA
TTAATTCTGGTTTCAATTATTCAAGTACCATGCGTAGTCATAGGAGTGCAATTTGGTTCTTTATTCAAGTTCCTGTGGGTAAGCACTGATCACGCTTACT[T/C]
GGCTTTGCCGGCAAATGCTAGGATGTATTCACTATTGTCCGGGATGGAAACTACTATTTCAATTCATACCTGCCCGGGATGGGAACTACTATCTTCTTTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.20% | 43.70% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 37.80% | 62.00% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 4.70% | 94.60% | 0.67% | 0.00% | NA |
| Indica II | 465 | 40.60% | 59.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 63.50% | 36.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 31.20% | 68.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 69.80% | 30.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 33.30% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208883943 | A -> G | LOC_Os02g15760.1 | upstream_gene_variant ; 1283.0bp to feature; MODIFIER | silent_mutation | Average:21.223; most accessible tissue: Minghui63 young leaf, score: 28.65 | N | N | N | N |
| vg0208883943 | A -> G | LOC_Os02g15760-LOC_Os02g15770 | intergenic_region ; MODIFIER | silent_mutation | Average:21.223; most accessible tissue: Minghui63 young leaf, score: 28.65 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208883943 | NA | 1.07E-08 | mr1050 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208883943 | NA | 4.10E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208883943 | NA | 3.54E-07 | mr1150 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208883943 | NA | 6.11E-12 | mr1272 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208883943 | NA | 1.46E-09 | mr1278 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208883943 | NA | 2.40E-07 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208883943 | NA | 5.08E-07 | mr1832 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208883943 | NA | 1.18E-06 | mr1918 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208883943 | NA | 3.76E-11 | mr1893_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |