Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208883943:

Variant ID: vg0208883943 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 8883943
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.66, A: 0.33, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

CAAAGAAGATAGTAGTTCCCATCCCGGGCAGGTATGAATTGAAATAGTAGTTTCCATCCCGGACAATAGTGAATACATCCTAGCATTTGCCGGCAAAGCC[A/G]
AGTAAGCGTGATCAGTGCTTACCCACAGGAACTTGAATAAAGAACCAAATTGCACTCCTATGACTACGCATGGTACTTGAATAATTGAAACCAGAATTAA

Reverse complement sequence

TTAATTCTGGTTTCAATTATTCAAGTACCATGCGTAGTCATAGGAGTGCAATTTGGTTCTTTATTCAAGTTCCTGTGGGTAAGCACTGATCACGCTTACT[T/C]
GGCTTTGCCGGCAAATGCTAGGATGTATTCACTATTGTCCGGGATGGAAACTACTATTTCAATTCATACCTGCCCGGGATGGGAACTACTATCTTCTTTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.20%	43.70%	0.19%	0.00%	NA
All Indica	2759	37.80%	62.00%	0.25%	0.00%	NA
All Japonica	1512	97.90%	2.10%	0.00%	0.00%	NA
Aus	269	2.60%	97.40%	0.00%	0.00%	NA
Indica I	595	4.70%	94.60%	0.67%	0.00%	NA
Indica II	465	40.60%	59.10%	0.22%	0.00%	NA
Indica III	913	63.50%	36.50%	0.00%	0.00%	NA
Indica Intermediate	786	31.20%	68.60%	0.25%	0.00%	NA
Temperate Japonica	767	98.30%	1.70%	0.00%	0.00%	NA
Tropical Japonica	504	97.80%	2.20%	0.00%	0.00%	NA
Japonica Intermediate	241	96.70%	3.30%	0.00%	0.00%	NA
VI/Aromatic	96	69.80%	30.20%	0.00%	0.00%	NA
Intermediate	90	64.40%	33.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208883943	A -> G	LOC_Os02g15760.1	upstream_gene_variant ; 1283.0bp to feature; MODIFIER	silent_mutation	Average:21.223; most accessible tissue: Minghui63 young leaf, score: 28.65	N	N	N	N
vg0208883943	A -> G	LOC_Os02g15760-LOC_Os02g15770	intergenic_region ; MODIFIER	silent_mutation	Average:21.223; most accessible tissue: Minghui63 young leaf, score: 28.65	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208883943	NA	1.07E-08	mr1050	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208883943	NA	4.10E-06	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208883943	NA	3.54E-07	mr1150	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208883943	NA	6.11E-12	mr1272	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208883943	NA	1.46E-09	mr1278	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208883943	NA	2.40E-07	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208883943	NA	5.08E-07	mr1832	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208883943	NA	1.18E-06	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208883943	NA	3.76E-11	mr1893_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251