\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208783825:

Variant ID: vg0208783825 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8783825
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


GGCGGTCGGGACAACCGCGGTGGGGAGCGGGCGGTGGTGGCGGTGGGGACGAGGCGGTGGGGAAATGAAGCCATTTATTACATAGCCGAGATCGGTGTTG[T/C]
CCCTGCTCACCTCTAACATGGCCGCGGTCTTCTTGGGGCTCGGGTACTCCGCGGAGCTTGGGCGCCGCCGTTTCTTGCCCTTTTTCATTGCAATCATGGC

Reverse complement sequence

GCCATGATTGCAATGAAAAAGGGCAAGAAACGGCGGCGCCCAAGCTCCGCGGAGTACCCGAGCCCCAAGAAGACCGCGGCCATGTTAGAGGTGAGCAGGG[A/G]
CAACACCGATCTCGGCTATGTAATAAATGGCTTCATTTCCCCACCGCCTCGTCCCCACCGCCACCACCGCCCGCTCCCCACCGCGGTTGTCCCGACCGCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.60% 42.40% 0.78% 0.21% NA
All Indica  2759 37.20% 61.30% 1.20% 0.36% NA
All Japonica  1512 98.50% 1.50% 0.00% 0.00% NA
Aus  269 6.70% 92.60% 0.74% 0.00% NA
Indica I  595 2.90% 97.00% 0.17% 0.00% NA
Indica II  465 27.50% 68.20% 3.66% 0.65% NA
Indica III  913 70.60% 28.40% 0.44% 0.55% NA
Indica Intermediate  786 29.90% 68.40% 1.40% 0.25% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 65.60% 32.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208783825 T -> DEL N N silent_mutation Average:84.633; most accessible tissue: Zhenshan97 panicle, score: 94.668 N N N N
vg0208783825 T -> C LOC_Os02g15630.1 upstream_gene_variant ; 96.0bp to feature; MODIFIER silent_mutation Average:84.633; most accessible tissue: Zhenshan97 panicle, score: 94.668 N N N N
vg0208783825 T -> C LOC_Os02g15620.1 downstream_gene_variant ; 2202.0bp to feature; MODIFIER silent_mutation Average:84.633; most accessible tissue: Zhenshan97 panicle, score: 94.668 N N N N
vg0208783825 T -> C LOC_Os02g15620-LOC_Os02g15630 intergenic_region ; MODIFIER silent_mutation Average:84.633; most accessible tissue: Zhenshan97 panicle, score: 94.668 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0208783825 T C -0.02 -0.01 -0.01 -0.02 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208783825 NA 1.15E-32 mr1074 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208783825 NA 5.31E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208783825 NA 7.82E-22 mr1254 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208783825 NA 4.48E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208783825 NA 6.40E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208783825 NA 1.69E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208783825 NA 9.70E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208783825 NA 2.24E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208783825 NA 5.78E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208783825 NA 5.01E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208783825 NA 4.07E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208783825 NA 2.78E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208783825 NA 4.57E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208783825 NA 1.11E-10 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208783825 NA 1.01E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208783825 2.19E-06 NA mr1929 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208783825 9.90E-06 1.27E-06 mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208783825 NA 1.02E-16 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208783825 NA 6.58E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208783825 NA 7.30E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251