\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208756843:

Variant ID: vg0208756843 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8756843
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, T: 0.06, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


TCAAATACATGCCACTACATCTGGTTAATCGCTAAAAAATCATATTAGAACTAGATAGTGATAGATTTGTGAGCCATATCATTTAATTTACGAGACAACG[T/A]
TTTCAGTTATCACTACTACTTTTTCTAAGTATTATAACTACCGTGAATAAAGTTTTATTTTACATATCTTCTATGGTGCATAAAATTTTTTCAATAATAA

Reverse complement sequence

TTATTATTGAAAAAATTTTATGCACCATAGAAGATATGTAAAATAAAACTTTATTCACGGTAGTTATAATACTTAGAAAAAGTAGTAGTGATAACTGAAA[A/T]
CGTTGTCTCGTAAATTAAATGATATGGCTCACAAATCTATCACTATCTAGTTCTAATATGATTTTTTAGCGATTAACCAGATGTAGTGGCATGTATTTGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.70% 47.00% 0.17% 0.08% NA
All Indica  2759 34.00% 65.70% 0.18% 0.14% NA
All Japonica  1512 92.40% 7.60% 0.00% 0.00% NA
Aus  269 7.80% 92.20% 0.00% 0.00% NA
Indica I  595 30.40% 69.20% 0.34% 0.00% NA
Indica II  465 11.80% 87.70% 0.22% 0.22% NA
Indica III  913 50.50% 49.30% 0.00% 0.22% NA
Indica Intermediate  786 30.70% 69.00% 0.25% 0.13% NA
Temperate Japonica  767 90.00% 10.00% 0.00% 0.00% NA
Tropical Japonica  504 94.80% 5.20% 0.00% 0.00% NA
Japonica Intermediate  241 95.00% 5.00% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 12.50% 1.04% 0.00% NA
Intermediate  90 57.80% 40.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208756843 T -> A LOC_Os02g15580.1 upstream_gene_variant ; 2728.0bp to feature; MODIFIER silent_mutation Average:48.044; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N
vg0208756843 T -> A LOC_Os02g15594.1 upstream_gene_variant ; 3159.0bp to feature; MODIFIER silent_mutation Average:48.044; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N
vg0208756843 T -> A LOC_Os02g15580.3 upstream_gene_variant ; 802.0bp to feature; MODIFIER silent_mutation Average:48.044; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N
vg0208756843 T -> A LOC_Os02g15580.2 upstream_gene_variant ; 802.0bp to feature; MODIFIER silent_mutation Average:48.044; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N
vg0208756843 T -> A LOC_Os02g15580-LOC_Os02g15594 intergenic_region ; MODIFIER silent_mutation Average:48.044; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N
vg0208756843 T -> DEL N N silent_mutation Average:48.044; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208756843 NA 8.54E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208756843 NA 2.62E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208756843 NA 2.11E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208756843 NA 2.68E-11 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208756843 NA 6.65E-08 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208756843 NA 4.02E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208756843 NA 9.81E-06 mr1448 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208756843 NA 5.31E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208756843 NA 5.28E-14 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208756843 5.74E-06 2.40E-08 mr1579 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208756843 NA 5.57E-14 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208756843 NA 1.34E-06 mr1701 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251