\
| Variant ID: vg0208756843 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8756843 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, T: 0.06, others allele: 0.00, population size: 222. )
TCAAATACATGCCACTACATCTGGTTAATCGCTAAAAAATCATATTAGAACTAGATAGTGATAGATTTGTGAGCCATATCATTTAATTTACGAGACAACG[T/A]
TTTCAGTTATCACTACTACTTTTTCTAAGTATTATAACTACCGTGAATAAAGTTTTATTTTACATATCTTCTATGGTGCATAAAATTTTTTCAATAATAA
TTATTATTGAAAAAATTTTATGCACCATAGAAGATATGTAAAATAAAACTTTATTCACGGTAGTTATAATACTTAGAAAAAGTAGTAGTGATAACTGAAA[A/T]
CGTTGTCTCGTAAATTAAATGATATGGCTCACAAATCTATCACTATCTAGTTCTAATATGATTTTTTAGCGATTAACCAGATGTAGTGGCATGTATTTGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.70% | 47.00% | 0.17% | 0.08% | NA |
| All Indica | 2759 | 34.00% | 65.70% | 0.18% | 0.14% | NA |
| All Japonica | 1512 | 92.40% | 7.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 7.80% | 92.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 30.40% | 69.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 11.80% | 87.70% | 0.22% | 0.22% | NA |
| Indica III | 913 | 50.50% | 49.30% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 30.70% | 69.00% | 0.25% | 0.13% | NA |
| Temperate Japonica | 767 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 86.50% | 12.50% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 40.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208756843 | T -> A | LOC_Os02g15580.1 | upstream_gene_variant ; 2728.0bp to feature; MODIFIER | silent_mutation | Average:48.044; most accessible tissue: Minghui63 flag leaf, score: 65.44 | N | N | N | N |
| vg0208756843 | T -> A | LOC_Os02g15594.1 | upstream_gene_variant ; 3159.0bp to feature; MODIFIER | silent_mutation | Average:48.044; most accessible tissue: Minghui63 flag leaf, score: 65.44 | N | N | N | N |
| vg0208756843 | T -> A | LOC_Os02g15580.3 | upstream_gene_variant ; 802.0bp to feature; MODIFIER | silent_mutation | Average:48.044; most accessible tissue: Minghui63 flag leaf, score: 65.44 | N | N | N | N |
| vg0208756843 | T -> A | LOC_Os02g15580.2 | upstream_gene_variant ; 802.0bp to feature; MODIFIER | silent_mutation | Average:48.044; most accessible tissue: Minghui63 flag leaf, score: 65.44 | N | N | N | N |
| vg0208756843 | T -> A | LOC_Os02g15580-LOC_Os02g15594 | intergenic_region ; MODIFIER | silent_mutation | Average:48.044; most accessible tissue: Minghui63 flag leaf, score: 65.44 | N | N | N | N |
| vg0208756843 | T -> DEL | N | N | silent_mutation | Average:48.044; most accessible tissue: Minghui63 flag leaf, score: 65.44 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208756843 | NA | 8.54E-11 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208756843 | NA | 2.62E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208756843 | NA | 2.11E-06 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208756843 | NA | 2.68E-11 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208756843 | NA | 6.65E-08 | mr1336 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208756843 | NA | 4.02E-07 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208756843 | NA | 9.81E-06 | mr1448 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208756843 | NA | 5.31E-06 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208756843 | NA | 5.28E-14 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208756843 | 5.74E-06 | 2.40E-08 | mr1579 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208756843 | NA | 5.57E-14 | mr1701 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208756843 | NA | 1.34E-06 | mr1701 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |