\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208726203:

Variant ID: vg0208726203 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8726203
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.01, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


TGAAAAATACTTTCATAAAAGTATACATATATCACTTTTCAATAAATATTTTTATAGAAACAAGAAGTTAAAGTTATGTTTTAGAGACCGTGTCGCTGTC[C/A]
TAAACGACTAAACGACTTCCTTTACGAGTACGGAAGGAGTACCAAATTTCCAGCATACTAGACTTTGGAGAATTGTATTACAGACAAACTTTGGAACGAA

Reverse complement sequence

TTCGTTCCAAAGTTTGTCTGTAATACAATTCTCCAAAGTCTAGTATGCTGGAAATTTGGTACTCCTTCCGTACTCGTAAAGGAAGTCGTTTAGTCGTTTA[G/T]
GACAGCGACACGGTCTCTAAAACATAACTTTAACTTCTTGTTTCTATAAAAATATTTATTGAAAAGTGATATATGTATACTTTTATGAAAGTATTTTTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.10% 0.30% 1.95% 58.61% NA
All Indica  2759 14.30% 0.50% 1.59% 83.62% NA
All Japonica  1512 88.10% 0.00% 2.71% 9.19% NA
Aus  269 8.90% 0.70% 0.37% 89.96% NA
Indica I  595 30.80% 0.50% 2.02% 66.72% NA
Indica II  465 8.00% 0.40% 1.29% 90.32% NA
Indica III  913 4.90% 0.30% 1.53% 93.21% NA
Indica Intermediate  786 16.50% 0.60% 1.53% 81.30% NA
Temperate Japonica  767 90.00% 0.00% 4.30% 5.74% NA
Tropical Japonica  504 85.10% 0.00% 0.79% 14.09% NA
Japonica Intermediate  241 88.40% 0.00% 1.66% 9.96% NA
VI/Aromatic  96 54.20% 0.00% 1.04% 44.79% NA
Intermediate  90 51.10% 0.00% 5.56% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208726203 C -> A LOC_Os02g15550.2 downstream_gene_variant ; 409.0bp to feature; MODIFIER silent_mutation Average:59.439; most accessible tissue: Callus, score: 88.647 N N N N
vg0208726203 C -> A LOC_Os02g15550.1 downstream_gene_variant ; 409.0bp to feature; MODIFIER silent_mutation Average:59.439; most accessible tissue: Callus, score: 88.647 N N N N
vg0208726203 C -> A LOC_Os02g15550.3 downstream_gene_variant ; 409.0bp to feature; MODIFIER silent_mutation Average:59.439; most accessible tissue: Callus, score: 88.647 N N N N
vg0208726203 C -> A LOC_Os02g15540-LOC_Os02g15550 intergenic_region ; MODIFIER silent_mutation Average:59.439; most accessible tissue: Callus, score: 88.647 N N N N
vg0208726203 C -> DEL N N silent_mutation Average:59.439; most accessible tissue: Callus, score: 88.647 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208726203 NA 1.72E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 1.56E-10 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 4.28E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 2.77E-06 mr1293 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 9.60E-06 mr1294 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 3.17E-10 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 1.58E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 2.72E-06 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 1.33E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 9.33E-09 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 3.28E-13 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 2.00E-06 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 4.88E-09 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 7.50E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 1.48E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 3.87E-09 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 6.84E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 2.27E-07 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 7.71E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 3.29E-06 1.89E-18 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 2.42E-07 mr1579 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 8.58E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 7.67E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 1.23E-13 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 2.90E-10 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 5.33E-17 mr1701 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 6.41E-06 mr1701 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 7.07E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 4.89E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 7.32E-09 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 1.72E-08 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 5.03E-07 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 1.65E-13 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208726203 NA 3.23E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251