\
| Variant ID: vg0208709176 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8709176 |
| Reference Allele: G | Alternative Allele: T,A |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 122. )
TTAGAAGCCCATCTAACAAACATTTGTTAGAAGCCCACCCAACAAACATTTTGTTATTAGAATAGTTTTGTTTGGGTTGATAAAATTCATGTCCTTTTTT[G/T,A]
ATTAGTAACAAATGTCTAATTTACTATCTTATCATGGAATATATTGTTCCACCTACATTTAGTTTTTTAGGTAGAGTAAAGGATAGCGAATAAAAAGTTT
AAACTTTTTATTCGCTATCCTTTACTCTACCTAAAAAACTAAATGTAGGTGGAACAATATATTCCATGATAAGATAGTAAATTAGACATTTGTTACTAAT[C/A,T]
AAAAAAGGACATGAATTTTATCAACCCAAACAAAACTATTCTAATAACAAAATGTTTGTTGGGTGGGCTTCTAACAAATGTTTGTTAGATGGGCTTCTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.50% | 14.00% | 0.38% | 0.00% | A: 0.02% |
| All Indica | 2759 | 77.40% | 22.50% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 97.00% | 2.00% | 0.99% | 0.00% | A: 0.07% |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 77.10% | 22.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 63.70% | 36.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 81.40% | 18.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 81.20% | 18.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 96.90% | 1.30% | 1.83% | 0.00% | NA |
| Tropical Japonica | 504 | 96.20% | 3.60% | 0.00% | 0.00% | A: 0.20% |
| Japonica Intermediate | 241 | 98.80% | 0.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208709176 | G -> A | LOC_Os02g15530.1 | upstream_gene_variant ; 1909.0bp to feature; MODIFIER | silent_mutation | Average:30.276; most accessible tissue: Callus, score: 62.78 | N | N | N | N |
| vg0208709176 | G -> A | LOC_Os02g15540.1 | downstream_gene_variant ; 4919.0bp to feature; MODIFIER | silent_mutation | Average:30.276; most accessible tissue: Callus, score: 62.78 | N | N | N | N |
| vg0208709176 | G -> A | LOC_Os02g15530-LOC_Os02g15540 | intergenic_region ; MODIFIER | silent_mutation | Average:30.276; most accessible tissue: Callus, score: 62.78 | N | N | N | N |
| vg0208709176 | G -> T | LOC_Os02g15530.1 | upstream_gene_variant ; 1909.0bp to feature; MODIFIER | silent_mutation | Average:30.276; most accessible tissue: Callus, score: 62.78 | N | N | N | N |
| vg0208709176 | G -> T | LOC_Os02g15540.1 | downstream_gene_variant ; 4919.0bp to feature; MODIFIER | silent_mutation | Average:30.276; most accessible tissue: Callus, score: 62.78 | N | N | N | N |
| vg0208709176 | G -> T | LOC_Os02g15530-LOC_Os02g15540 | intergenic_region ; MODIFIER | silent_mutation | Average:30.276; most accessible tissue: Callus, score: 62.78 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208709176 | 2.40E-06 | 5.71E-10 | mr1929 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208709176 | NA | 8.43E-06 | mr1929 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208709176 | NA | 1.15E-06 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |