\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208709176:

Variant ID: vg0208709176 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8709176
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGAAGCCCATCTAACAAACATTTGTTAGAAGCCCACCCAACAAACATTTTGTTATTAGAATAGTTTTGTTTGGGTTGATAAAATTCATGTCCTTTTTT[G/T,A]
ATTAGTAACAAATGTCTAATTTACTATCTTATCATGGAATATATTGTTCCACCTACATTTAGTTTTTTAGGTAGAGTAAAGGATAGCGAATAAAAAGTTT

Reverse complement sequence

AAACTTTTTATTCGCTATCCTTTACTCTACCTAAAAAACTAAATGTAGGTGGAACAATATATTCCATGATAAGATAGTAAATTAGACATTTGTTACTAAT[C/A,T]
AAAAAAGGACATGAATTTTATCAACCCAAACAAAACTATTCTAATAACAAAATGTTTGTTGGGTGGGCTTCTAACAAATGTTTGTTAGATGGGCTTCTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.50% 14.00% 0.38% 0.00% A: 0.02%
All Indica  2759 77.40% 22.50% 0.11% 0.00% NA
All Japonica  1512 97.00% 2.00% 0.99% 0.00% A: 0.07%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 77.10% 22.50% 0.34% 0.00% NA
Indica II  465 63.70% 36.30% 0.00% 0.00% NA
Indica III  913 81.40% 18.60% 0.00% 0.00% NA
Indica Intermediate  786 81.20% 18.70% 0.13% 0.00% NA
Temperate Japonica  767 96.90% 1.30% 1.83% 0.00% NA
Tropical Japonica  504 96.20% 3.60% 0.00% 0.00% A: 0.20%
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208709176 G -> A LOC_Os02g15530.1 upstream_gene_variant ; 1909.0bp to feature; MODIFIER silent_mutation Average:30.276; most accessible tissue: Callus, score: 62.78 N N N N
vg0208709176 G -> A LOC_Os02g15540.1 downstream_gene_variant ; 4919.0bp to feature; MODIFIER silent_mutation Average:30.276; most accessible tissue: Callus, score: 62.78 N N N N
vg0208709176 G -> A LOC_Os02g15530-LOC_Os02g15540 intergenic_region ; MODIFIER silent_mutation Average:30.276; most accessible tissue: Callus, score: 62.78 N N N N
vg0208709176 G -> T LOC_Os02g15530.1 upstream_gene_variant ; 1909.0bp to feature; MODIFIER silent_mutation Average:30.276; most accessible tissue: Callus, score: 62.78 N N N N
vg0208709176 G -> T LOC_Os02g15540.1 downstream_gene_variant ; 4919.0bp to feature; MODIFIER silent_mutation Average:30.276; most accessible tissue: Callus, score: 62.78 N N N N
vg0208709176 G -> T LOC_Os02g15530-LOC_Os02g15540 intergenic_region ; MODIFIER silent_mutation Average:30.276; most accessible tissue: Callus, score: 62.78 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208709176 2.40E-06 5.71E-10 mr1929 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208709176 NA 8.43E-06 mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208709176 NA 1.15E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251