| Variant ID: vg0208707423 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8707423 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.15, others allele: 0.00, population size: 104. )
TGAAGTCCCCACTGCAATTTGAGAGAATCTATTCTATACCACTGAGTTTATCATAGTTCAACAATTTACCATTGACTTTGTCTCTTTCTACAATATACCG[G/A]
TGACTTTATCAATTGTTCTACAATATGTCATTGCGTTGAGCCTATTTTTCAATAATACCTAAAATACCCTTATGTACGTATAAGGTTAACAATTGATTTA
TAAATCAATTGTTAACCTTATACGTACATAAGGGTATTTTAGGTATTATTGAAAAATAGGCTCAACGCAATGACATATTGTAGAACAATTGATAAAGTCA[C/T]
CGGTATATTGTAGAAAGAGACAAAGTCAATGGTAAATTGTTGAACTATGATAAACTCAGTGGTATAGAATAGATTCTCTCAAATTGCAGTGGGGACTTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.30% | 22.70% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 67.40% | 32.60% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 69.90% | 30.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 90.80% | 9.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 49.80% | 50.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 72.00% | 27.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 64.60% | 35.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208707423 | G -> A | LOC_Os02g15520.1 | upstream_gene_variant ; 4340.0bp to feature; MODIFIER | silent_mutation | Average:47.781; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0208707423 | G -> A | LOC_Os02g15530.1 | upstream_gene_variant ; 156.0bp to feature; MODIFIER | silent_mutation | Average:47.781; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0208707423 | G -> A | LOC_Os02g15520.2 | upstream_gene_variant ; 4328.0bp to feature; MODIFIER | silent_mutation | Average:47.781; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0208707423 | G -> A | LOC_Os02g15530-LOC_Os02g15540 | intergenic_region ; MODIFIER | silent_mutation | Average:47.781; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208707423 | NA | 1.54E-06 | mr1319 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208707423 | NA | 1.15E-06 | mr1336 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208707423 | NA | 4.26E-06 | mr1359 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208707423 | 5.64E-06 | 5.69E-07 | mr1378 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208707423 | 2.37E-07 | NA | mr1579 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208707423 | 9.95E-06 | 3.87E-08 | mr1579 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208707423 | NA | 9.67E-06 | mr1635 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |