Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0208707423:

Variant ID: vg0208707423 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 8707423
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.15, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

TGAAGTCCCCACTGCAATTTGAGAGAATCTATTCTATACCACTGAGTTTATCATAGTTCAACAATTTACCATTGACTTTGTCTCTTTCTACAATATACCG[G/A]
TGACTTTATCAATTGTTCTACAATATGTCATTGCGTTGAGCCTATTTTTCAATAATACCTAAAATACCCTTATGTACGTATAAGGTTAACAATTGATTTA

Reverse complement sequence

TAAATCAATTGTTAACCTTATACGTACATAAGGGTATTTTAGGTATTATTGAAAAATAGGCTCAACGCAATGACATATTGTAGAACAATTGATAAAGTCA[C/T]
CGGTATATTGTAGAAAGAGACAAAGTCAATGGTAAATTGTTGAACTATGATAAACTCAGTGGTATAGAATAGATTCTCTCAAATTGCAGTGGGGACTTCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.30%	22.70%	0.02%	0.00%	NA
All Indica	2759	67.40%	32.60%	0.04%	0.00%	NA
All Japonica	1512	91.70%	8.30%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	69.90%	30.10%	0.00%	0.00%	NA
Indica II	465	90.80%	9.20%	0.00%	0.00%	NA
Indica III	913	49.80%	50.20%	0.00%	0.00%	NA
Indica Intermediate	786	72.00%	27.90%	0.13%	0.00%	NA
Temperate Japonica	767	94.10%	5.90%	0.00%	0.00%	NA
Tropical Japonica	504	88.50%	11.50%	0.00%	0.00%	NA
Japonica Intermediate	241	90.90%	9.10%	0.00%	0.00%	NA
VI/Aromatic	96	64.60%	35.40%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208707423	G -> A	LOC_Os02g15520.1	upstream_gene_variant ; 4340.0bp to feature; MODIFIER	silent_mutation	Average:47.781; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0208707423	G -> A	LOC_Os02g15530.1	upstream_gene_variant ; 156.0bp to feature; MODIFIER	silent_mutation	Average:47.781; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0208707423	G -> A	LOC_Os02g15520.2	upstream_gene_variant ; 4328.0bp to feature; MODIFIER	silent_mutation	Average:47.781; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0208707423	G -> A	LOC_Os02g15530-LOC_Os02g15540	intergenic_region ; MODIFIER	silent_mutation	Average:47.781; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208707423	NA	1.54E-06	mr1319	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208707423	NA	1.15E-06	mr1336	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208707423	NA	4.26E-06	mr1359	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208707423	5.64E-06	5.69E-07	mr1378	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208707423	2.37E-07	NA	mr1579	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208707423	9.95E-06	3.87E-08	mr1579	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208707423	NA	9.67E-06	mr1635	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251