\
| Variant ID: vg0208695804 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8695804 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CAGCATTGTCAGCCATACAAAATACGAAGCAAAGCGAACGGCACATCAAACACAAATACATATAATCTCTAAAACAGATCAGGATACATAGATAAGATTA[G/C]
AAATGACATGAGTGGATGCAAATACTGTTCAGGCGATGAATTGAAGATCTGGTGATCAAGGCACATGTATAACTTTGATTGCAGTAGTAGTGTCACGCAT
ATGCGTGACACTACTACTGCAATCAAAGTTATACATGTGCCTTGATCACCAGATCTTCAATTCATCGCCTGAACAGTATTTGCATCCACTCATGTCATTT[C/G]
TAATCTTATCTATGTATCCTGATCTGTTTTAGAGATTATATGTATTTGTGTTTGATGTGCCGTTCGCTTTGCTTCGTATTTTGTATGGCTGACAATGCTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.60% | 3.50% | 0.89% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.00% | 0.72% | 0.00% | NA |
| All Japonica | 1512 | 87.70% | 11.00% | 1.26% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 0.00% | 1.51% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.00% | 0.65% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 0.00% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 77.80% | 19.80% | 2.35% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 0.00% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208695804 | G -> C | LOC_Os02g15520.1 | downstream_gene_variant ; 4621.0bp to feature; MODIFIER | silent_mutation | Average:22.195; most accessible tissue: Callus, score: 39.527 | N | N | N | N |
| vg0208695804 | G -> C | LOC_Os02g15520.2 | downstream_gene_variant ; 4621.0bp to feature; MODIFIER | silent_mutation | Average:22.195; most accessible tissue: Callus, score: 39.527 | N | N | N | N |
| vg0208695804 | G -> C | LOC_Os02g15510.1 | intron_variant ; MODIFIER | silent_mutation | Average:22.195; most accessible tissue: Callus, score: 39.527 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208695804 | NA | 3.17E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208695804 | NA | 8.48E-07 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208695804 | 7.28E-06 | NA | mr1203 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208695804 | NA | 8.86E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208695804 | 6.31E-06 | NA | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208695804 | NA | 1.09E-08 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208695804 | NA | 5.33E-06 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208695804 | 6.91E-06 | NA | mr1897 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208695804 | 2.68E-06 | 1.45E-06 | mr1897 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208695804 | 4.02E-06 | NA | mr1071_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208695804 | 2.64E-06 | NA | mr1203_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208695804 | 4.93E-06 | NA | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208695804 | NA | 1.20E-07 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208695804 | 1.08E-06 | NA | mr1317_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208695804 | 5.94E-06 | 5.95E-06 | mr1317_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208695804 | 2.72E-08 | 7.76E-09 | mr1585_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208695804 | 9.53E-06 | 5.80E-11 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208695804 | 7.70E-06 | NA | mr1619_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208695804 | 2.01E-07 | NA | mr1897_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208695804 | 2.21E-06 | 2.21E-06 | mr1897_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |