Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208677057:

Variant ID: vg0208677057 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 8677057
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTTCATTTAAAAATTATCACATGGAAGCATTTTTAGCTCTTTGCCCATTAAACATTCTGTAAACCCGCCATGTAGTACTTCTACACACACTTCTACGC[C/T]
GCCACGTGACATTTCAATAAATTAGAAAAATCATAAAAATTATGAGAATAAACAAAATATCTGGTTGTCGATTTTCACTGATATGTGGTGGACCCATTGT

Reverse complement sequence

ACAATGGGTCCACCACATATCAGTGAAAATCGACAACCAGATATTTTGTTTATTCTCATAATTTTTATGATTTTTCTAATTTATTGAAATGTCACGTGGC[G/A]
GCGTAGAAGTGTGTGTAGAAGTACTACATGGCGGGTTTACAGAATGTTTAATGGGCAAAGAGCTAAAAATGCTTCCATGTGATAATTTTTAAATGAAAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.90%	2.70%	3.32%	13.06%	NA
All Indica	2759	87.50%	0.10%	1.05%	11.34%	NA
All Japonica	1512	68.40%	8.10%	8.07%	15.41%	NA
Aus	269	95.20%	0.00%	0.37%	4.46%	NA
Indica I	595	78.50%	0.00%	1.01%	20.50%	NA
Indica II	465	84.50%	0.00%	1.08%	14.41%	NA
Indica III	913	95.00%	0.10%	1.42%	3.50%	NA
Indica Intermediate	786	87.40%	0.30%	0.64%	11.70%	NA
Temperate Japonica	767	87.10%	1.40%	3.13%	8.34%	NA
Tropical Japonica	504	43.30%	19.60%	13.29%	23.81%	NA
Japonica Intermediate	241	61.40%	5.40%	12.86%	20.33%	NA
VI/Aromatic	96	38.50%	0.00%	4.17%	57.29%	NA
Intermediate	90	92.20%	2.20%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208677057	C -> T	LOC_Os02g15500.1	upstream_gene_variant ; 2332.0bp to feature; MODIFIER	silent_mutation	Average:13.208; most accessible tissue: Callus, score: 38.869	N	N	N	N
vg0208677057	C -> T	LOC_Os02g15490.1	downstream_gene_variant ; 2962.0bp to feature; MODIFIER	silent_mutation	Average:13.208; most accessible tissue: Callus, score: 38.869	N	N	N	N
vg0208677057	C -> T	LOC_Os02g15490-LOC_Os02g15500	intergenic_region ; MODIFIER	silent_mutation	Average:13.208; most accessible tissue: Callus, score: 38.869	N	N	N	N
vg0208677057	C -> DEL	N	N	silent_mutation	Average:13.208; most accessible tissue: Callus, score: 38.869	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208677057	NA	6.68E-06	mr1177	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	NA	1.12E-06	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	NA	8.95E-06	mr1263	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	NA	4.41E-06	mr1293	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	NA	1.15E-06	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	NA	5.94E-06	mr1318	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	NA	2.96E-07	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	NA	7.15E-06	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	NA	2.13E-06	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	NA	8.95E-06	mr1451	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	NA	2.63E-07	mr1507	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	NA	2.17E-06	mr1507	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	NA	2.98E-06	mr1531	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	NA	6.24E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	NA	1.89E-08	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	NA	1.48E-06	mr1604	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	NA	5.06E-10	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	NA	3.18E-08	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	NA	5.07E-08	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	NA	1.35E-06	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	NA	3.08E-06	mr1809	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	NA	1.65E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	NA	3.28E-07	mr1906	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	NA	2.20E-06	mr1906	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	3.36E-06	1.94E-07	mr1991	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208677057	NA	1.85E-07	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251