Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208547952:

Variant ID: vg0208547952 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 8547952
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.01, others allele: 0.00, population size: 118. )

Flanking Sequence (100 bp) in Reference Genome:

TAGGAAATTAATCCATCCTCAAAACGTGGACACAAAATAGTCTGAACTATAGAATAGAACAAATATAATAAAAACCGGTGCTTTTTGCAGGATTTTTTTT[A/T]
AAAAAATCATATGTTAATGCAACGCAAGAACTCTGTACCTGTTGTGAGCTCTTCTTTATACTCACAATTCCTTTTCAAAAGTTCTCCCTTGCAATGCCTC

Reverse complement sequence

GAGGCATTGCAAGGGAGAACTTTTGAAAAGGAATTGTGAGTATAAAGAAGAGCTCACAACAGGTACAGAGTTCTTGCGTTGCATTAACATATGATTTTTT[T/A]
AAAAAAAATCCTGCAAAAAGCACCGGTTTTTATTATATTTGTTCTATTCTATAGTTCAGACTATTTTGTGTCCACGTTTTGAGGATGGATTAATTTCCTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.40%	36.90%	8.13%	17.58%	NA
All Indica	2759	29.80%	30.30%	12.25%	27.69%	NA
All Japonica	1512	53.00%	44.90%	1.59%	0.46%	NA
Aus	269	37.50%	40.50%	5.20%	16.73%	NA
Indica I	595	37.10%	15.50%	20.00%	27.39%	NA
Indica II	465	15.70%	43.40%	11.40%	29.46%	NA
Indica III	913	37.90%	26.90%	8.43%	26.73%	NA
Indica Intermediate	786	23.20%	37.50%	11.32%	27.99%	NA
Temperate Japonica	767	72.80%	24.90%	1.43%	0.91%	NA
Tropical Japonica	504	29.80%	68.70%	1.59%	0.00%	NA
Japonica Intermediate	241	39.00%	58.90%	2.07%	0.00%	NA
VI/Aromatic	96	15.60%	81.20%	2.08%	1.04%	NA
Intermediate	90	30.00%	47.80%	6.67%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208547952	A -> T	LOC_Os02g15300.1	downstream_gene_variant ; 4447.0bp to feature; MODIFIER	silent_mutation	Average:39.934; most accessible tissue: Minghui63 flower, score: 60.681	N	N	N	N
vg0208547952	A -> T	LOC_Os02g15300-LOC_Os02g15310	intergenic_region ; MODIFIER	silent_mutation	Average:39.934; most accessible tissue: Minghui63 flower, score: 60.681	N	N	N	N
vg0208547952	A -> DEL	N	N	silent_mutation	Average:39.934; most accessible tissue: Minghui63 flower, score: 60.681	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208547952	NA	6.02E-06	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208547952	NA	2.48E-06	mr1232	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208547952	2.83E-06	1.76E-08	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208547952	1.50E-06	1.50E-06	mr1392	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208547952	4.39E-06	NA	mr1401	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208547952	NA	7.74E-07	mr1507	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208547952	NA	9.99E-06	mr1516	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208547952	NA	9.28E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251