\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208547952:

Variant ID: vg0208547952 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8547952
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.01, others allele: 0.00, population size: 118. )

Flanking Sequence (100 bp) in Reference Genome:


TAGGAAATTAATCCATCCTCAAAACGTGGACACAAAATAGTCTGAACTATAGAATAGAACAAATATAATAAAAACCGGTGCTTTTTGCAGGATTTTTTTT[A/T]
AAAAAATCATATGTTAATGCAACGCAAGAACTCTGTACCTGTTGTGAGCTCTTCTTTATACTCACAATTCCTTTTCAAAAGTTCTCCCTTGCAATGCCTC

Reverse complement sequence

GAGGCATTGCAAGGGAGAACTTTTGAAAAGGAATTGTGAGTATAAAGAAGAGCTCACAACAGGTACAGAGTTCTTGCGTTGCATTAACATATGATTTTTT[T/A]
AAAAAAAATCCTGCAAAAAGCACCGGTTTTTATTATATTTGTTCTATTCTATAGTTCAGACTATTTTGTGTCCACGTTTTGAGGATGGATTAATTTCCTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.40% 36.90% 8.13% 17.58% NA
All Indica  2759 29.80% 30.30% 12.25% 27.69% NA
All Japonica  1512 53.00% 44.90% 1.59% 0.46% NA
Aus  269 37.50% 40.50% 5.20% 16.73% NA
Indica I  595 37.10% 15.50% 20.00% 27.39% NA
Indica II  465 15.70% 43.40% 11.40% 29.46% NA
Indica III  913 37.90% 26.90% 8.43% 26.73% NA
Indica Intermediate  786 23.20% 37.50% 11.32% 27.99% NA
Temperate Japonica  767 72.80% 24.90% 1.43% 0.91% NA
Tropical Japonica  504 29.80% 68.70% 1.59% 0.00% NA
Japonica Intermediate  241 39.00% 58.90% 2.07% 0.00% NA
VI/Aromatic  96 15.60% 81.20% 2.08% 1.04% NA
Intermediate  90 30.00% 47.80% 6.67% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208547952 A -> T LOC_Os02g15300.1 downstream_gene_variant ; 4447.0bp to feature; MODIFIER silent_mutation Average:39.934; most accessible tissue: Minghui63 flower, score: 60.681 N N N N
vg0208547952 A -> T LOC_Os02g15300-LOC_Os02g15310 intergenic_region ; MODIFIER silent_mutation Average:39.934; most accessible tissue: Minghui63 flower, score: 60.681 N N N N
vg0208547952 A -> DEL N N silent_mutation Average:39.934; most accessible tissue: Minghui63 flower, score: 60.681 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208547952 NA 6.02E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208547952 NA 2.48E-06 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208547952 2.83E-06 1.76E-08 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208547952 1.50E-06 1.50E-06 mr1392 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208547952 4.39E-06 NA mr1401 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208547952 NA 7.74E-07 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208547952 NA 9.99E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208547952 NA 9.28E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251