\
| Variant ID: vg0208547952 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8547952 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.01, others allele: 0.00, population size: 118. )
TAGGAAATTAATCCATCCTCAAAACGTGGACACAAAATAGTCTGAACTATAGAATAGAACAAATATAATAAAAACCGGTGCTTTTTGCAGGATTTTTTTT[A/T]
AAAAAATCATATGTTAATGCAACGCAAGAACTCTGTACCTGTTGTGAGCTCTTCTTTATACTCACAATTCCTTTTCAAAAGTTCTCCCTTGCAATGCCTC
GAGGCATTGCAAGGGAGAACTTTTGAAAAGGAATTGTGAGTATAAAGAAGAGCTCACAACAGGTACAGAGTTCTTGCGTTGCATTAACATATGATTTTTT[T/A]
AAAAAAAATCCTGCAAAAAGCACCGGTTTTTATTATATTTGTTCTATTCTATAGTTCAGACTATTTTGTGTCCACGTTTTGAGGATGGATTAATTTCCTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.40% | 36.90% | 8.13% | 17.58% | NA |
| All Indica | 2759 | 29.80% | 30.30% | 12.25% | 27.69% | NA |
| All Japonica | 1512 | 53.00% | 44.90% | 1.59% | 0.46% | NA |
| Aus | 269 | 37.50% | 40.50% | 5.20% | 16.73% | NA |
| Indica I | 595 | 37.10% | 15.50% | 20.00% | 27.39% | NA |
| Indica II | 465 | 15.70% | 43.40% | 11.40% | 29.46% | NA |
| Indica III | 913 | 37.90% | 26.90% | 8.43% | 26.73% | NA |
| Indica Intermediate | 786 | 23.20% | 37.50% | 11.32% | 27.99% | NA |
| Temperate Japonica | 767 | 72.80% | 24.90% | 1.43% | 0.91% | NA |
| Tropical Japonica | 504 | 29.80% | 68.70% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 39.00% | 58.90% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 15.60% | 81.20% | 2.08% | 1.04% | NA |
| Intermediate | 90 | 30.00% | 47.80% | 6.67% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208547952 | A -> T | LOC_Os02g15300.1 | downstream_gene_variant ; 4447.0bp to feature; MODIFIER | silent_mutation | Average:39.934; most accessible tissue: Minghui63 flower, score: 60.681 | N | N | N | N |
| vg0208547952 | A -> T | LOC_Os02g15300-LOC_Os02g15310 | intergenic_region ; MODIFIER | silent_mutation | Average:39.934; most accessible tissue: Minghui63 flower, score: 60.681 | N | N | N | N |
| vg0208547952 | A -> DEL | N | N | silent_mutation | Average:39.934; most accessible tissue: Minghui63 flower, score: 60.681 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208547952 | NA | 6.02E-06 | mr1231 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208547952 | NA | 2.48E-06 | mr1232 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208547952 | 2.83E-06 | 1.76E-08 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208547952 | 1.50E-06 | 1.50E-06 | mr1392 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208547952 | 4.39E-06 | NA | mr1401 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208547952 | NA | 7.74E-07 | mr1507 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208547952 | NA | 9.99E-06 | mr1516 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208547952 | NA | 9.28E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |