RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0208546299:

Variant ID: vg0208546299 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 8546299
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCGCGCGCGGGTGCTAGCACATCTGCGTGTGGCGTTCCGTCCCTGTACATGTGGATACCGGTAGAGGCGCCGCTGGTTTGCGGTGCTGATCGCCGTGGGA[G/A]
TACGGCGAGGAGAACACACGAGGAGGAGAAGGTCGAGCCGGTGCGATCTACTACTTCCTCTACATCGACGCGCGCTACTTCGCGAGAGTTCCTTCGACTT

Reverse complement sequence

AAGTCGAAGGAACTCTCGCGAAGTAGCGCGCGTCGATGTAGAGGAAGTAGTAGATCGCACCGGCTCGACCTTCTCCTCCTCGTGTGTTCTCCTCGCCGTA[C/T]
TCCCACGGCGATCAGCACCGCAAACCAGCGGCGCCTCTACCGGTATCCACATGTACAGGGACGGAACGCCACACGCAGATGTGCTAGCACCCGCGCGCGG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.20%	3.60%	2.14%	0.00%	NA
All Indica	2759	99.90%	0.00%	0.07%	0.00%	NA
All Japonica	1512	82.50%	11.10%	6.35%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	79.40%	13.00%	7.56%	0.00%	NA
Tropical Japonica	504	95.80%	2.20%	1.98%	0.00%	NA
Japonica Intermediate	241	64.70%	23.70%	11.62%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	3.30%	3.33%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208546299	G -> A	LOC_Os02g15290.1	upstream_gene_variant ; 4174.0bp to feature; MODIFIER	silent_mutation	Average:63.709; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0208546299	G -> A	LOC_Os02g15300.1	downstream_gene_variant ; 2794.0bp to feature; MODIFIER	silent_mutation	Average:63.709; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0208546299	G -> A	LOC_Os02g15300-LOC_Os02g15310	intergenic_region ; MODIFIER	silent_mutation	Average:63.709; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208546299	NA	9.31E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208546299	4.46E-06	NA	mr1045	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208546299	4.16E-06	4.15E-06	mr1061	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208546299	5.41E-06	NA	mr1117	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208546299	NA	1.60E-07	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208546299	NA	1.22E-07	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208546299	NA	1.44E-07	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208546299	3.74E-06	NA	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208546299	2.09E-06	NA	mr1236	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208546299	5.78E-06	NA	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 48 entries

Previous1 2 3 4 5Next

Search for Variation information by Variation ID:

Detailed information for vg0208546299:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact