\
| Variant ID: vg0208482033 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr02 | Position: 8482033 |
| Reference Allele: TGTAAA | Alternative Allele: AGTAAA,T |
| Primary Allele: AGTAAA | Secondary Allele: TGTAAA |
Inferred Ancestral Allele: Not determined.
GCTCGCTGGTTCTCGAACCAGTAAACCGTAGCAATCTCTCGCACCACAGCTTCCATTGGCGTTCGAGAGATAATTCTACTCGCTCGCTGGTTCTCGAACC[TGTAAA/AGTAAA,T]
CCGTAGCAATCTCTCGCACCGCAGCTTCCATTGGTGTTCAAGAGATAATTCTACCCGCTCGCTGGTTCTCGAACCAGTAAACCGTAGCAATCTCTCGCAC
GTGCGAGAGATTGCTACGGTTTACTGGTTCGAGAACCAGCGAGCGGGTAGAATTATCTCTTGAACACCAATGGAAGCTGCGGTGCGAGAGATTGCTACGG[TTTACA/TTTACT,A]
GGTTCGAGAACCAGCGAGCGAGTAGAATTATCTCTCGAACGCCAATGGAAGCTGTGGTGCGAGAGATTGCTACGGTTTACTGGTTCGAGAACCAGCGAGC
| Populations | Population Size | Frequency of AGTAAA(primary allele) | Frequency of TGTAAA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.30% | 30.20% | 3.49% | 15.02% | NA |
| All Indica | 2759 | 72.90% | 5.90% | 5.33% | 15.88% | NA |
| All Japonica | 1512 | 2.90% | 80.60% | 0.60% | 15.87% | NA |
| Aus | 269 | 96.30% | 2.60% | 1.12% | 0.00% | NA |
| Indica I | 595 | 55.00% | 3.40% | 6.72% | 34.96% | NA |
| Indica II | 465 | 79.10% | 3.00% | 7.53% | 10.32% | NA |
| Indica III | 913 | 85.10% | 3.00% | 3.29% | 8.65% | NA |
| Indica Intermediate | 786 | 68.70% | 12.80% | 5.34% | 13.10% | NA |
| Temperate Japonica | 767 | 1.80% | 95.80% | 0.00% | 2.35% | NA |
| Tropical Japonica | 504 | 4.00% | 53.60% | 1.79% | 40.67% | NA |
| Japonica Intermediate | 241 | 4.10% | 88.80% | 0.00% | 7.05% | NA |
| VI/Aromatic | 96 | 61.50% | 13.50% | 2.08% | 22.92% | NA |
| Intermediate | 90 | 54.40% | 30.00% | 4.44% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208482033 | TGTAAA -> T | LOC_Os02g15200.1 | downstream_gene_variant ; 2427.0bp to feature; MODIFIER | N | Average:28.249; most accessible tissue: Minghui63 flag leaf, score: 58.568 | N | N | N | N |
| vg0208482033 | TGTAAA -> T | LOC_Os02g15210.1 | downstream_gene_variant ; 261.0bp to feature; MODIFIER | N | Average:28.249; most accessible tissue: Minghui63 flag leaf, score: 58.568 | N | N | N | N |
| vg0208482033 | TGTAAA -> T | LOC_Os02g15210-LOC_Os02g15220 | intergenic_region ; MODIFIER | N | Average:28.249; most accessible tissue: Minghui63 flag leaf, score: 58.568 | N | N | N | N |
| vg0208482033 | TGTAAA -> AGTAAA | LOC_Os02g15200.1 | downstream_gene_variant ; 2426.0bp to feature; MODIFIER | silent_mutation | Average:28.249; most accessible tissue: Minghui63 flag leaf, score: 58.568 | N | N | N | N |
| vg0208482033 | TGTAAA -> AGTAAA | LOC_Os02g15210.1 | downstream_gene_variant ; 260.0bp to feature; MODIFIER | silent_mutation | Average:28.249; most accessible tissue: Minghui63 flag leaf, score: 58.568 | N | N | N | N |
| vg0208482033 | TGTAAA -> AGTAAA | LOC_Os02g15210-LOC_Os02g15220 | intergenic_region ; MODIFIER | silent_mutation | Average:28.249; most accessible tissue: Minghui63 flag leaf, score: 58.568 | N | N | N | N |
| vg0208482033 | TGTAAA -> DEL | N | N | silent_mutation | Average:28.249; most accessible tissue: Minghui63 flag leaf, score: 58.568 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208482033 | NA | 1.16E-10 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208482033 | NA | 5.73E-06 | mr1515 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208482033 | NA | 1.14E-06 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208482033 | NA | 2.21E-10 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208482033 | NA | 3.94E-18 | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208482033 | NA | 9.11E-07 | mr1874_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |