Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208482033:

Variant ID: vg0208482033 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 8482033
Reference Allele: TGTAAA	Alternative Allele: AGTAAA,T
Primary Allele: AGTAAA	Secondary Allele: TGTAAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCTCGCTGGTTCTCGAACCAGTAAACCGTAGCAATCTCTCGCACCACAGCTTCCATTGGCGTTCGAGAGATAATTCTACTCGCTCGCTGGTTCTCGAACC[TGTAAA/AGTAAA,T]
CCGTAGCAATCTCTCGCACCGCAGCTTCCATTGGTGTTCAAGAGATAATTCTACCCGCTCGCTGGTTCTCGAACCAGTAAACCGTAGCAATCTCTCGCAC

Reverse complement sequence

GTGCGAGAGATTGCTACGGTTTACTGGTTCGAGAACCAGCGAGCGGGTAGAATTATCTCTTGAACACCAATGGAAGCTGCGGTGCGAGAGATTGCTACGG[TTTACA/TTTACT,A]
GGTTCGAGAACCAGCGAGCGAGTAGAATTATCTCTCGAACGCCAATGGAAGCTGTGGTGCGAGAGATTGCTACGGTTTACTGGTTCGAGAACCAGCGAGC

Allele Frequencies:

Populations	Population Size	Frequency of AGTAAA(primary allele)	Frequency of TGTAAA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.30%	30.20%	3.49%	15.02%	NA
All Indica	2759	72.90%	5.90%	5.33%	15.88%	NA
All Japonica	1512	2.90%	80.60%	0.60%	15.87%	NA
Aus	269	96.30%	2.60%	1.12%	0.00%	NA
Indica I	595	55.00%	3.40%	6.72%	34.96%	NA
Indica II	465	79.10%	3.00%	7.53%	10.32%	NA
Indica III	913	85.10%	3.00%	3.29%	8.65%	NA
Indica Intermediate	786	68.70%	12.80%	5.34%	13.10%	NA
Temperate Japonica	767	1.80%	95.80%	0.00%	2.35%	NA
Tropical Japonica	504	4.00%	53.60%	1.79%	40.67%	NA
Japonica Intermediate	241	4.10%	88.80%	0.00%	7.05%	NA
VI/Aromatic	96	61.50%	13.50%	2.08%	22.92%	NA
Intermediate	90	54.40%	30.00%	4.44%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208482033	TGTAAA -> T	LOC_Os02g15200.1	downstream_gene_variant ; 2427.0bp to feature; MODIFIER	N	Average:28.249; most accessible tissue: Minghui63 flag leaf, score: 58.568	N	N	N	N
vg0208482033	TGTAAA -> T	LOC_Os02g15210.1	downstream_gene_variant ; 261.0bp to feature; MODIFIER	N	Average:28.249; most accessible tissue: Minghui63 flag leaf, score: 58.568	N	N	N	N
vg0208482033	TGTAAA -> T	LOC_Os02g15210-LOC_Os02g15220	intergenic_region ; MODIFIER	N	Average:28.249; most accessible tissue: Minghui63 flag leaf, score: 58.568	N	N	N	N
vg0208482033	TGTAAA -> AGTAAA	LOC_Os02g15200.1	downstream_gene_variant ; 2426.0bp to feature; MODIFIER	silent_mutation	Average:28.249; most accessible tissue: Minghui63 flag leaf, score: 58.568	N	N	N	N
vg0208482033	TGTAAA -> AGTAAA	LOC_Os02g15210.1	downstream_gene_variant ; 260.0bp to feature; MODIFIER	silent_mutation	Average:28.249; most accessible tissue: Minghui63 flag leaf, score: 58.568	N	N	N	N
vg0208482033	TGTAAA -> AGTAAA	LOC_Os02g15210-LOC_Os02g15220	intergenic_region ; MODIFIER	silent_mutation	Average:28.249; most accessible tissue: Minghui63 flag leaf, score: 58.568	N	N	N	N
vg0208482033	TGTAAA -> DEL	N	N	silent_mutation	Average:28.249; most accessible tissue: Minghui63 flag leaf, score: 58.568	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208482033	NA	1.16E-10	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208482033	NA	5.73E-06	mr1515	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208482033	NA	1.14E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208482033	NA	2.21E-10	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208482033	NA	3.94E-18	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208482033	NA	9.11E-07	mr1874_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251