\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208482033:

Variant ID: vg0208482033 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 8482033
Reference Allele: TGTAAAAlternative Allele: AGTAAA,T
Primary Allele: AGTAAASecondary Allele: TGTAAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTCGCTGGTTCTCGAACCAGTAAACCGTAGCAATCTCTCGCACCACAGCTTCCATTGGCGTTCGAGAGATAATTCTACTCGCTCGCTGGTTCTCGAACC[TGTAAA/AGTAAA,T]
CCGTAGCAATCTCTCGCACCGCAGCTTCCATTGGTGTTCAAGAGATAATTCTACCCGCTCGCTGGTTCTCGAACCAGTAAACCGTAGCAATCTCTCGCAC

Reverse complement sequence

GTGCGAGAGATTGCTACGGTTTACTGGTTCGAGAACCAGCGAGCGGGTAGAATTATCTCTTGAACACCAATGGAAGCTGCGGTGCGAGAGATTGCTACGG[TTTACA/TTTACT,A]
GGTTCGAGAACCAGCGAGCGAGTAGAATTATCTCTCGAACGCCAATGGAAGCTGTGGTGCGAGAGATTGCTACGGTTTACTGGTTCGAGAACCAGCGAGC

Allele Frequencies:

Populations Population SizeFrequency of AGTAAA(primary allele) Frequency of TGTAAA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.30% 30.20% 3.49% 15.02% NA
All Indica  2759 72.90% 5.90% 5.33% 15.88% NA
All Japonica  1512 2.90% 80.60% 0.60% 15.87% NA
Aus  269 96.30% 2.60% 1.12% 0.00% NA
Indica I  595 55.00% 3.40% 6.72% 34.96% NA
Indica II  465 79.10% 3.00% 7.53% 10.32% NA
Indica III  913 85.10% 3.00% 3.29% 8.65% NA
Indica Intermediate  786 68.70% 12.80% 5.34% 13.10% NA
Temperate Japonica  767 1.80% 95.80% 0.00% 2.35% NA
Tropical Japonica  504 4.00% 53.60% 1.79% 40.67% NA
Japonica Intermediate  241 4.10% 88.80% 0.00% 7.05% NA
VI/Aromatic  96 61.50% 13.50% 2.08% 22.92% NA
Intermediate  90 54.40% 30.00% 4.44% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208482033 TGTAAA -> T LOC_Os02g15200.1 downstream_gene_variant ; 2427.0bp to feature; MODIFIER N Average:28.249; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg0208482033 TGTAAA -> T LOC_Os02g15210.1 downstream_gene_variant ; 261.0bp to feature; MODIFIER N Average:28.249; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg0208482033 TGTAAA -> T LOC_Os02g15210-LOC_Os02g15220 intergenic_region ; MODIFIER N Average:28.249; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg0208482033 TGTAAA -> AGTAAA LOC_Os02g15200.1 downstream_gene_variant ; 2426.0bp to feature; MODIFIER silent_mutation Average:28.249; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg0208482033 TGTAAA -> AGTAAA LOC_Os02g15210.1 downstream_gene_variant ; 260.0bp to feature; MODIFIER silent_mutation Average:28.249; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg0208482033 TGTAAA -> AGTAAA LOC_Os02g15210-LOC_Os02g15220 intergenic_region ; MODIFIER silent_mutation Average:28.249; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg0208482033 TGTAAA -> DEL N N silent_mutation Average:28.249; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208482033 NA 1.16E-10 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208482033 NA 5.73E-06 mr1515 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208482033 NA 1.14E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208482033 NA 2.21E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208482033 NA 3.94E-18 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208482033 NA 9.11E-07 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251